THE INTERPLAY BETWEEN PRO-DEATH AND PRO-SURVIVAL
SIGNALING PATHWAYS CONVERGING AT MITOCHONDRIA IN
MYOCARDIAL ISCHEMIA/REPERFUSION: APOPTOSIS MEETS AUTOPHAGY
Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der Rheinisch-Westfälischen Technischen Hochschule Aachen zur Erlangung des akademischen Grades
einer Doktorin der Naturwissenschaften genehmigte Dissertation
vorgelegt von
Diplom-Biologin
Anne Hamacher
aus Aachen
Berichter: Universitätsprofessor Dr. Fritz Kreuzaler Privatdozent Dr. Christoph Peterhänsel
Tag der mündlichen Prüfung: 15. September 2006
Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfügbar.
FOR MY DAUGHTER ZOË The research described in this thesis was carried out at the Department of Molecular and Experimental Medicine of The Scripps Research Institute, California, USA under the auspices of the RWTH Aachen, Germany.
ABBREVIATIONS
.
i
Abbreviations
ADP adenosine diphosphate
AIF apoptosis-inducing factor
ANT adenine nucleotide translocator
Apaf-1 apoptotic protease activating factor 1
ATP adenosine triphosphate
AV(s) autophagic vacuole(s)
Baf A1 bafilomycin A1
Bax Bcl-2 associated X protein
Bcl-2 B-cell leukemia/lymphoma 2
BD binding domain
BH3 Bcl-2 homology domain 3
Bid Bcl-2 interacting domain
Bnip3 Bcl-2/adenovirus E1B 19 kDa interacting protein
CFP cyan fluorescent protein
Ca2+
calcium
CsA cyclosporin A
DCF 2',7'-dichlorofluorescein
CM-DCFH2-DA chloromethyl dichlorodihydrofluorescein diacetate
DNA deoxyribonucleic acid
∆Ψm mitochondrial transmembrane potential
EDTA ethylene diamine tetraacetic acid
ETC electron transport chain
FADD Fas-associated death domain
FADH2 1,5-dihydroflavin adenine dinucleotide
4D four-dimensional (X/Y/Z/time)
FRET fluorescence resonance energy transfer
GFP green fluorescent protein
GDP guanosine diphosphate
GTP guanosine triphosphate
H+ proton
IAPs inhibitor of apoptosis proteins
I/R ischemia/reperfusion
kDa kilo Dalton
KH Krebs-Henseleit
Lamp2 lysosomal-associated membrane protein 2
LC3 microtubule-associated protein light chain 3
LSCM laser scanning confocal microscopy
LTR LysoTracker Red
MAPK mitogen-activated protein kinase
MCS multiple cloning site
µM micro-molar (µmol/L)
mM mill-molar (mmol/L)
MPT(P) mitochondrial permeability transition (pore)
ABBREVIATIONS
.
ii
mRNA messenger ribonucleic acid
mTOR mammalian target of rapamycin
N.A. numerical apertur
NADH nicotinamide adenine dinucleotide
ORF open reading frame
PBS phosphate buffered saline
PCD programmed cell death
PE phosphatidylethanolamine
PI3-K phosphatidylinositol 3-kinase
PI3-P phosphatidylinositol 3-phosphate
RFP red fluorescent protein
RIRR ROS-induced ROS release
RNA ribonucleic acid
RNAi RNA interference
ROS reactive oxygen species
SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
S/ER sarco/endoplasmic reticulum
SERCA sarco/endoplasmic reticulum calcium ATPase
sI/R simulated ischemia/reperfusion
tBid truncated Bid
TM transmembrane
TMRM tetramethylrhodamine methyl ester
TNF-α tumor necrosis factor-α
TRADD TNF-α-associated death domain
3D 3-dimensional (X/Y/Z)
3-MA 3-methyladenine
v-ATPase vacuolar ATPase
VDAC voltage dependent anion channel
YFP yellow fluorescent protein
TABLE OF CONTENTS
.
iii
Table of contents
Abbreviations……………………………………………………………………………..i
Table of contents…………………………………………………………………………iii
I Introduction ……...………………………………...……...………………………….1
I-1 Heart disease ....................................................................................................... 3
I-2 The heart and its working units........................................................................... 4
I-3 Myocardial cell death during I/R injury.............................................................. 5
I-3.1 Pathways and executers of apoptosis (PCD type I) ........................................ 6
I-3.1.1 Receptor-mediated death pathway.......................................................... 7
I-3.1.2 Mitochondrial death pathway ................................................................. 7
I-3.2 Death signaling at the mitochondria ............................................................... 9
I-3.2.1 Mitochondrial permeability transition.................................................. 10
I-3.2.2 Mitochondrial ROS generation............................................................. 10
I-3.2.3 Mitochondrial calcium handling........................................................... 11
I-3.3 Regulation of mitochondrial integrity by Bcl-2 family members................. 12
I-3.3.1 Anti-apoptotic Bcl-2 family members ................................................... 13
I-3.3.2 Pro-apoptotic Bcl-2 family members .................................................... 14
I-4 Autophagy – at the interface between death and survival ................................ 15
I-4.1 Molecular mechanism of autophagy............................................................. 15
I-4.1.1 Autophagosome formation .................................................................... 16
I-4.1.2 Autophagosome maturation .................................................................. 19
I-4.1.3 Degradation within the autophagolysosome ........................................ 19
I-4.2 Regulation of autophagy............................................................................... 20
I-4.2.1 Negative regulation of autophagy......................................................... 20
I-4.2.2 Positive regulation of autophagy .......................................................... 20
I-4.3 Cross-talk of autophagy and apoptosis: Bcl-2 family members ................... 21
I-4.3.1 Anti-apoptotic Bcl-2 family members ................................................... 22
I-4.3.2 Pro-apoptotic Bcl-2 family members .................................................... 22
I-4.4 Autophagy in the heart.................................................................................. 23
I-5 Thesis objectives............................................................................................... 24
I-5.1 Cell culture model of I/R injury to the heart................................................. 24
I-5.2 Elucidation of the regulation of Beclin1-mediated autophagy ..................... 24
I-5.3 Role of Beclin1-mediated autophagy in myocardial I/R injury.................... 25
I-5.4 Connection between mitochondrial dysfunction and autophagy.................. 25
I Materials and Methods ……...……………………..……...……………………….27
II-1 Materials ........................................................................................................... 29
II-1.1 Antibodies ................................................................................................. 29
II-1.1.1 Primary antibodies............................................................................ 29
II-1.1.2 Horseradish peroxidase-conjugated secondary antibodies.............. 30
II-2 Methods............................................................................................................. 30
TABLE OF CONTENTS
.
iv
II-2.1 Cloning and plasmid construction ............................................................ 30
II-2.1.1 pmCherry-C1 .................................................................................... 31
II-2.1.2 mCherry-Bax..................................................................................... 31
II-2.1.3 Mito-ECFP........................................................................................ 31
II-2.1.4 YFP-Bid-CFP.................................................................................... 32
II-2.1.5 mCherry-Atg5 ................................................................................... 32
II-2.2 Site-directed mutagenesis ......................................................................... 32
II-2.2.1 mCherry-BaxT182A
.............................................................................. 33
II-2.2.2 YFP-Bid∆∆∆∆casp8-CFP ........................................................................ 33
II-2.2.3 mCherry- Atg5K130R
........................................................................... 33
II-2.3 RNA interference ...................................................................................... 33
II-2.3.1 Bnip3 ................................................................................................. 34
II-2.3.2 Beclin1 .............................................................................................. 34
II-2.4 Cell culture................................................................................................ 34
II-2.5 Transfections............................................................................................. 35
II-2.5.1 Effectene transfection protocol ......................................................... 35
II-2.5.2 Lipofectamine transfection protocol ................................................. 35
II-2.6 High and low nutrient condition ............................................................... 36
II-2.7 Simulated ischemia/reperfusion (sI/R) ..................................................... 36
II-2.8 Fluorescence microscopy.......................................................................... 36
II-2.8.1 Widefield fluorescence microscopy................................................... 36
II-2.8.2 Laser Scanning Confocal Microscopy (LSCM) ................................ 37
II-2.9 Detection of ROS and ∆Ψm ...................................................................... 37
II-2.10 Assessment of mitochondrial morphology ............................................... 38
II-2.11 Quantification of cellular injury................................................................ 38
II-2.11.1 Redistribution of (mCherry-)GFP-Bax ............................................. 38
II-2.11.2 Plasma membrane integrity .............................................................. 38
II-2.12 Quantification of cellular autophagosome content ................................... 39
II-2.13 Determination of LC3-II degradation ....................................................... 39
II-2.14 Activity of the lysosomal compartment.................................................... 39
II-2.15 Ca2+
imaging ............................................................................................. 40
II-2.16 Image processing and analysis.................................................................. 40
II-2.17 Immunoblotting......................................................................................... 41
II-2.18 Statistics .................................................................................................... 41
III-VI Results……...………………………………...……………………..…….…….43
III Pro-apoptotic Bcl-2 family members and mitochondrial dysfunction during
ischemia/reperfusion injury……………………………………………………………43
III-1 Simulated I/R in HL-1 cardiac myocytes induces mitochondrial dysfunction .
.. and PCD............................................................................................................ 45
III-2 Mitochondrial dysfunction and fragmentation.................................................. 46
III-2.1 sI/R-induced mitochondrial fragmentation is mediated by Drp1 ............. 48
III-3 Bax activation in sI/R........................................................................................ 48
III-3.1 Bax translocation and clustering............................................................... 50
TABLE OF CONTENTS
.
v
III-3.2 Bax translocation and clustering, mitochondrial fragmentation, and ∆Ψm...
................................................................................................................... 51
III-4 GFP-Bax clustering as a parameter of sI/R-induced injury.............................. 53
III-5 Drp1-mediated mitochondrial fragmentation protects against sI/R.................. 57
III-6 Bid activation in sI/R monitored by a GFP biosensor ...................................... 57
III-6.1 sI/R-induced cardiac myocyte Bid cleavage is mediated by caspase 8 .... 58
III-7 Spatio-temporally resolved interplay of Bid and Bax at the mitochondria ...... 61
IV Bcl-2 regulation of sarco/endoplasmic reticulum calcium stores mediates the
autophagic response to nutrient deprivation in HL-1 cardiac myocytes……………65
IV-1 Inhibiting lysosomal activity to quantify autophagic flux ................................ 65
IV-2 Quantifying autophagy in HL-1 cardiac myocytes........................................... 67
IV-2.1 Pharmacologic activation of autophagy.................................................... 67
IV-2.2 Autophagic response to nutrient deprivation ............................................ 69
IV-2.3 Molecular perturbation of the autophagic pathway .................................. 70
IV-2.4 Beclin1 control of the autophagic response to nutrient deprivation is ..
………dependent on a functional Bcl-2/-xL binding domain............................... 72
IV-3 Bcl-2 suppression of the autophagic response to nutrient deprivation is ..
………dependent on its subcellular localization .................................................. 73
IV-4 Bcl-2 overexpression inhibits autophagy due to depletion of sequestered S/ER
… Ca2+
stores ......................................................................................................... 75
IV-5 Positive regulation of autophagy by S/ER Ca2+ .............................................. 76
V Enhancing macroautophagy protects against ischemia/reperfusion injury in
HL-1 cardiac myocytes......…………………………………………………………81
V-1 Cellular autophagosomal content is increased during the early phase of sI/R
…………injury................................................................................................................. 81
V-2 Changes in autophagic activity during ischemia an reperfusion ...................... 83
V-2.1 Flux of LC3-II degradation during sI/R.................................................... 83
V-2.2 Lysosomal activity during sI/R................................................................. 85
V-3 Unraveling the role of autophagy in sI/R injury ............................................... 86
V-3.1 Pharmacological perturbation of autophagy induction influences sI/R
………injury…..…………………………………………………………………86
V-3.2 Beclin1 protects from sI/R-activated injury and increases autophagic flux .
……………………………………………………………………………90
V-3.3 Beclin1 protection against sI/R injury requires a functional Bcl-2 binding
………domain.…………………………………………………………………...92
V-3.4 Inhibition of Atg5 aggravates injury and counteracts protection conferred
………by Beclin1 ................................................................................................. 94
VI Mitophagy as part of the autophagic survival response during
ischemia/reperfusion injury in HL-1 cardiac myocytes…………………………….100
TABLE OF CONTENTS
.
vi
VI-1 Fragmented mitochondria are targets of autophagy during reperfusion ............... 100
VI-2 Bnip3 overexpression as a surrogate for sI/R-induced mitochondrial
dysfunction............................................................................................................. 102
VI-3 Bnip3 induces autophagy in cardiac HL-1 cells.................................................... 104
VI-4 Bnip3 causes autophagy of mitochondrial fragments ........................................... 106
VI-5 Autophagy is a protective response against Bnip3-induced cell death ................. 107
VII Discussion……………..…………………………………………………………114
VII-1 Chapter I: HL-1 cell culture model of myocardial I/R injury allowing for the
spatio-temporal investigation of apoptosis-related signaling pathways ......................... 114
VII-1.1 Mitochondrial dysfunction is an early event in sI/R injury to HL-1 cardiac
myocytes ............................................................................................................. 115
VII-1.2 Pro-apoptotic Bax activity ...................................................................... 115
VII-1.3 Bid activation and translocation.............................................................. 116
VII-1.4 Bcl-2 and Bax activation: role of subcellular localization...................... 117
VII-1.5 sI/R-induced mitochondrial fragmentation ............................................. 117
VII-1.6 Conclusions............................................................................................. 119
VII-2 Chapter IV: Investigating autophagy in HL-1 cardiac myocytes .................. 120
VII-2.1 Determination of autophagic flux ........................................................... 120
VII-2.2 Regulation of Beclin1-mediated autophagy............................................ 121
VII-2.2.1 Endogenous Bcl-2 promotes Beclin1-mediated autophagy during
nutrient deprivation ........................................................................................ 121
VII-2.2.2 S/ER-localized Bcl-2 depletes S/ER Ca2+
-content, thereby inhibiting
autophagy........................................................................................................ 122
VII-2.3 Conclusions: Chapter IV......................................................................... 123
VII-3 Chapter V: Autophagy in sI/R ....................................................................... 123
VII-3.1 Autophagic flux during sI/R ................................................................... 123
VII-3.2 Enhancing autophagic flux protects against sI/R injury ......................... 125
VII-3.3 Protection, Bcl-2, and autophagy............................................................ 125
VII-3.4 Conclusions: Chapter V .......................................................................... 126
VII-4 Chapter VI: Nature of protection exerted by autophagy: role of mitophagy. 127
VII-4.1 Autophagic scavenging of mitochondria (mitophagy) during sI/R ........ 128
VII-4.2 Bnip3 and activation of the sI/R apoptotic pathway............................... 128
VII-4.2.1 Bnip3, mitochondrial fragmentation, and autophagy..................... 129
VII-4.2.2 Autophagy protects against Bnip3 apoptotic signaling .................. 129
VII-4.2.3 Signal for mitophagy?..................................................................... 129
VII-4.3 Conclusions............................................................................................. 130
VII-5 Perspectives: Significance in the heart ........................................................... 130
VIII Summary……………………………………………………………………….133
IX References……………………………………………………………………...137
X Appendix……………………………………………………………………….155
Chapter 1
Introduction
________________________________________________________________________
Adapted from: Hamacher-Brady A., Brady N.R., and R.A. Gottlieb. “The interplay between pro-
death and pro-survival signaling pathways in myocardial ischemia/reperfusion: apoptosis meets
autophagy.” Cardiovasc Drugs Ther.
INTRODUCTION
I
3
I-1 Heart disease
The heart is a muscular pump which is responsible for circulating blood throughout the
body, in order to deliver cells with nutrients and oxygen, the substrate permitting aerobic
metabolism, as well as to carry away their waste products. The human heart begins
beating at approximately 4-5 weeks following conception and continues, hopefully
uninterrupted, until death, beating around 3 billion times.
Despite its central importance, the working conditions of the average heart are
worsening. Approximately one third of all deaths in the Western industrialized world are
caused by the effects of acute or chronic limitations to coronary blood flow (Thom et al.,
2006). Many of these deaths are attributable to modifiable risk factors, such as obesity,
hypertension, and smoking (Ellsworth et al., 1999; Poulter, 2003), which are prevalent
and increasing throughout the world. Thus, in all likelihood heart disease will remain the
leading cause of death for generations to come.
A crucial event in the development of heart disease is the hardening and
narrowing of the blood-supplying arteries (atherosclerosis, coronary heart disease). Key
to the pathogenesis is the abundance of cholesterol (Huxley et al., 2002), a component of
cell membranes which serves to regulate membrane fluidity and permeability. High
levels of low-density-lipoprotein (LDL)-cholesterol lead to the gradual build-up of
plaques, which in severe conditions results in reduced blood supply and thus, insufficient
oxygenation of myocardial tissues. As a consequence, the heart loses its ability to
properly circulate blood throughout the body, the condition referred to as congestive
heart failure.
A myocardial infarction, or heart attack, occurs when a coronary artery supplying
oxygen-rich blood to a region of the heart is blocked (e.g. due to coronary obstruction,
surgical clamp, heart transplantation). The resulting condition of low oxygen and
nutrient supply is termed ischemia (from Greek: ‘ischo’, to hold back, and ‘haima’,
blood), and is accompanied by decreased intracellular availability of ATP, and low pH,
partly due to increased lactate concentrations. Following a bout of ischemia, reperfusion
(e.g. via vasodilator pharmaceuticals, angioplasty) must be achieved in order to prevent
the irreversible destruction of affected tissues. Paradoxically, reperfusion itself causes
INTRODUCTION
I
4
damage and subsequent cell death. This condition is referred to as ischemia/reperfusion
(I/R) injury.
Mitochondria, the ‘powerhouses’ of the cell, are key integrators and controllers of
the pathways mediating I/R injury. Depending on the magnitude of the insult,
mitochondria either promote cellular survival (Oldenburg et al., 2002) or transform into
lethal entities, executing cell death (Gustafsson and Gottlieb, 2003; Crow et al., 2004).
The mitochondrial response is in part controlled by the interplay between pro-life and
pro-death Bcl-2 family members which decides the prevalence of survival or death
signals. Understanding the events leading to and stemming from mitochondrial
dysfunction is crucial for the ultimate goal of treating heart disease and preventing I/R-
activated cell death.
I-2 The heart and its working units
The heart is divided into two upper chambers, the atria, and two lower chambers, the
ventricles. Contraction of the right ventricle pumps blood from the Vena cava inferior
and superior via the Aorta pulmonalis through the lungs. Simultaneous contraction of the
more powerful left ventricle pumps the oxygenated blood through the aorta into the body.
Pumping of the blood is accomplished via the rhythmic sequence of contraction (systole)
and relaxation (diastole). The blood supply of the body (~five liters in an adult) is
circulated once per minute. This astonishing pumping action is generated through highly
coordinated contraction of a mesh of billions of heart muscle cells, known as cardiac
myocytes or cardiomyocytes, which are interconnected via gap junctions (Severs, 2000).
Cardiac myocytes are a terminally differentiated cell type, i.e. they do not divide and thus
are of limited number. There is a recent debate whether cardiac myocytes are
regenerated within the heart (Anversa et al., 2006); however, any innate regenerative
capability can not be sufficient to recover from most pathologies.
Cardiac myocytes have a high energy expenditure and accordingly 30% of the
cardiac cellular volume is accounted for by mitochondria (Page et al., 1971), which are
responsible for almost all the supply of ATP. ATP is the free-energy carrier fuelling
most cellular energy-dependent operations; in the cardiac myocyte approximately 30% of
ATP is used to maintain calcium homeostasis and 60% is used to power contraction
INTRODUCTION
I
5
(Opie, 1998). Mitochondria generate ATP through a process termed oxidative
phosphorylation. Electrons originating from nutrients are carried to the electron transport
chain by NADH and FADH2 and then transferred along a series of carrier molecules in
the inner mitochondrial membrane, driving the extrusion of protons (H+) from the matrix
across the inner mitochondrial membrane into the mitochondrial intermembrane space to
form the protonmotive force (∆µH+). ∆µH
+ describes the electrochemical potential
difference for H+ across the inner mitochondrial membrane, which represents the net
electric potential difference (∆Ψm) and the difference in pH (∆pH). The free energy
contained within ∆µH+ can be used to drive H
+ back through the F1F0 ATPase into the
matrix whereby ADP is phosphorylated to generate ATP (Saraste, 1999b). Cardiac
myocytes must continually replenish their supply of ATP, which would be exhausted
within seconds in the absence of resynthesis: In a 70 kg individual, ATP turnover of the
human heart exceeds 6 kg per day, yet total ATP content in the heart amounts to about
3.5 grams (Ingwall, 2002).
I-3 Myocardial cell death during I/R injury
As discussed above, I/R injury is a major cause of cell death, leading to extensive loss of
myocardial tissue and consequently reduced myocardial function. It has been established
that cell death occurs via both necrosis and apoptosis (Kajstura et al., 1996), two distinct
modes of death. Necrosis (Greek for: death, causing to die) is a degenerative process in
which cellular integrity is lost and the release of cytosolic contents provokes an
inflammatory response (Searle et al., 1982). Ischemia induces necrosis in a certain
subset of cells, whereby the extent of necrotic cell loss is a function of the duration of the
ischemic insult. Necrotic cells are mainly found in the central zone of the infarct (infarct
= region of dead tissue).
In contrast, apoptosis (from Greek: ‘falling off’, figurative for the falling of
leaves; also termed programmed cell death (PCD) type I) is a highly-regulated,
genetically-determined mechanism that does not provoke an inflammatory response
(Saraste, 1999a). Moreover, apoptosis requires energy in form of ATP for its successful
completion. Apoptosis plays a role in pathophysiological conditions but is also essential
in normal tissue homeostasis, allowing the organ or tissue to rid itself of cells which are
INTRODUCTION
I
6
dysfunctional or no longer needed. Apoptotic cell death is characterized by cell
shrinkage, membrane blebbing, and nuclear condensation and degradation. The cell is
eventually broken into small membrane-enclosed pieces (apoptotic bodies), which in vivo
are removed by macrophages, or taken up by neighboring cells. This prevents the release
of cellular compounds and thus ensures that an inflammatory response is not provoked.
In I/R injury, apoptotic cell loss manifests itself during the reperfusion period due to the
slowly orchestrated execution of the apoptotic cell death program, and is more apparent
at the marginal zone of the infarct. In addition to its contribution to I/R injury, apoptosis
has been implicated in the pathogenesis of several cardiovascular diseases including
nonischemic dilated cardiomyopathy (Schoppet et al., 2005) and congestive heart failure
(Narula et al., 1996; Olivetti et al., 1997).
Recently, a second mode of programmed cell death (PCD type II), termed
autophagic cell death, has been discovered which is characterized morphologically by the
presence of numerous autophagic vacuoles (Bursch, 2001). Autophagy is a vital process
by which macromolecules and organelles are being delivered to lysosomal degradation
(see I.4). Uncontrolled or excessive autophagy is thought to cause cell death via the
extensive degradation of cytoplasmic constituents. Under these conditions
pharmacological or molecular inhibition of the components of the autophagic pathway
prevents cell death. Autophagic cell death has been implicated in heart failure (Knaapen
et al., 2001; Shimomura et al., 2001; Miyata et al., 2006) and myocardial hibernation
(Elsasser et al., 2004). However, the data used in the support of this hypothesis is
correlative or relies on the use of nonspecific inhibitors. To date there is no direct
evidence implicating autophagic cell death as a contributor to I/R injury.
I-3.1 Pathways and executers of apoptosis (PCD type I)
PCD presents a target for reducing the size of the infarct, and thus preserving myocardial
function following I/R injury. In the heart, apoptosis is mediated by two central
pathways, the receptor-mediated (extrinsic) and the mitochondrial (intrinsic) pathway
(Crow et al., 2004) both of which are depicted in Fig. 1. So-called caspases, a family of
cysteine aspartate proteases, are the main effectors of, and allow for crosstalk between,
both pathways (Thornberry and Lazebnik, 1998; Stennicke and Salvesen, 2000).
INTRODUCTION
I
7
Caspases are synthesized as inactive precursors and generally activated by proteolytic
cleavage of the procaspase form to the catalytically active heterotetramer (Shi, 2002).
I-3.1.1 Receptor-mediated death pathway
The receptor-mediated (extrinsic) pathway is initiated by the binding of a death ligand
(e.g. CD95 /Fas ligand, TNF-α) to its cognate cell surface death receptor (e.g. CD95/Fas,
TNF-α receptor) (Ashkenazi and Dixit, 1998; Schmitz et al., 2000). Consequently, death
adapter molecules such as FADD (Fas-associated death domain) and TRADD (TNF
receptor-accociated death domain) form homotrimers which are recruited to the
cytoplasmic tail of the death receptor through interactions between “death domains”
present in both proteins (Tartaglia and Goeddel, 1992; Chinnaiyan et al., 1995; Hsu et al.,
1995). Subsequently, procaspase 8 is recruited to the complex resulting in increased
proximity of the molecules which forces autocatalytic homooligomerization and
processing (Muzio et al., 1998). Once activated, caspase 8 initiates the apoptotic cascade
via processing of downstream effector caspases such as caspase 3 (Nicholson et al., 1995;
Tewari et al., 1995) and pro-apoptotic Bcl-2 family member Bid (Li et al., 1998), leading
to the death of the cell.
Recently, the receptor-mediated death pathway was linked to the progression of
heart disease: mice lacking functional Fas exhibited smaller infarcts following a model of
in vivo I/R injury (Lee et al., 2003), while increased levels of Fas ligand are present in
congestive heart failure (Schumann et al., 1997; Yamaguchi et al., 1999) and were
associated with I/R-induced apoptosis of cardiac myocytes (Kajstura et al., 1996).
Likewise, increased TNF-α production was reported to occur during myocardial I/R
injury and linked to mitochondrial damage (Lefer et al., 1990; Kimura et al., 2006).
I-3.1.2 Mitochondrial death pathway
Under pathophysiological conditions (e.g. enhanced oxidative stress and/or calcium
overload) mitochondria participate in the apoptotic pathway (Green and Reed, 1998;
Desagher and Martinou, 2000). Death signals transmitted to the mitochondria lead to the
release of pro-apoptotic proteins from the mitochondrial intermembrane space to the
cytosol, through pathways which are still subject to much debate and investigation. The
majority of studies focused on the release of cytochrome c, which normally functions as
INTRODUCTION
I
8
part of the mitochondrial electron transport chain. Two main models have been proposed
to describe the mechanism(s) of cytochrome c release to the cytosol (Bernardi et al.,
1999; Lim et al., 2002). The first model describes a non-specific mode of release in
which opening of the mitochondrial permeability transition pore (MPTP, I-3.2.1) leads to
the swelling of mitochondria due to the osmotic influx of water into the protein- and
metabolite-dense mitochondrial matrix. The highly convoluted inner mitochondrial
membrane is able to expand while the outer mitochondrial membrane ruptures, releasing
cytochrome c into the cytosol. The second model describes specific modes of release,
where Bcl-2 family proteins (I-3.3) either form pores directly via oligomerization,
regulate the pore size of pre-existing pores, or induce the formation of lipidic pores by
causing membrane instability.
In the cytosol, cytochrome c binds to Apaf1 (apoptotic protease activating factor
1) and, in the presence of dATP, procaspase 9 is recruited to the complex, now termed
the apoptosome, leading to the activation of procaspase 9 (Rodriguez and Lazebnik,
1999; Acehan et al., 2002). Activated caspase 9 can activate downstream effector
caspases, and thus determine the cell to death. Cytochrome c-dependent activation of
caspase 9 is supported by Smac/DIABLO which is likewise released from the
mitochondrial intermembrane space and removes the anti-apoptotic activity of IAPs
(inhibitor of apoptosis proteins) (Du et al., 2000; Verhagen et al., 2000). In addition,
mitochondria release endonuclease G and AIF (apoptosis-inducing factor) which
translocate to the nucleus and promote chromatin condensation and large-scale DNA
fragmentation (Sharpe et al., 2004).
The mitochondrial death pathway appears to play an important role in the
execution of apoptosis in cardiac myocytes (Gottlieb and Engler, 1999; Gustafsson and
Gottlieb, 2003; Crow et al., 2004). Caspase-dependent cytochrome c release has been
reported in isolated chick cardiac myocytes subjected to simulated I/R (Qin et al., 2004)
and several parameters of mitochondrial-mediated apoptosis were demonstrated during
myocardial I/R injury in vivo (Lundberg and Szweda, 2004) and in vitro (Chen et al.,
2001). Furthermore, preservation of mitochondrial integrity via inhibition of the MPTP
(Halestrap et al., 2004) or counterbalancing of pro-apoptotic Bcl-2 protein activity
(Brocheriou et al., 2000; Gustafsson et al., 2002) proved cardioprotective in I/R injury.
INTRODUCTION
I
9
Procaspase 8
Bid
tBid
CD95LCD95L
Receptor-mediated death pathway Mitochondrial death pathway
CD95CD95
FADDFADD
Caspase 8Procaspase 3
Caspase 3
Plasma membrane
Bax
Apaf-1
+ ATP
Apoptosome
Apoptotic substrates
EndoG
Smac/DIABLO
AIF
IAPs
Bcl-2/-xL
Procaspase 9
Cytochrome c
NucleusNucleus
Caspase 9
Mitochondrion
FIG. 1. Comprehensive schema of signaling pathways implicated in apoptosis (PCD type I) of cardiac myocytes. Depending on the stimuli apoptosis may be initiated extrinsically via the engagement of cell surface death receptors or intrinsically via the mitochondrial pathway. The receptor-mediated death pathway is initiated by binding of a death ligand (e.g. CD95L/FasL) to its cognate receptor (e.g. CD95/Fas) in the plasma membrane. The cytoplasmic tail of the death receptor then engages death adaptor molecules (e.g. FADD), resulting in the recruitment and activation of Procaspase 8. Caspase 8 activates downstream effector caspases such as caspase 3, resulting in the execution of apoptosis. Caspase 8 also activates Bid, thereby linking the two death pathways. The mitochondrial death pathway is regulated by the Bcl-2 family of proteins (see I.3.3). Cellular stresses are communicated to the mitochondria by pro-apoptotic Bcl-2 family members (e.g. Bid, Bax), leading to the release of pro-apoptotic molecules (e.g. cytochrome c, EndoG, AIF, Smac/DIABLO) from the mitochondrial intermembrane space into the cytosol where they initiate the apoptotic cascade. Anti-apoptotic Bcl-2 family members (e.g. Bcl-2 and Bcl-xL) oppose these actions.
I-3.2 Death signaling at the mitochondria
Mitochondria form a point of convergence and integration of both survival and death
signaling pathways. Mitochondria communicate death signals between mitochondria and
to other organelles such as the sarco-/endoplasmic reticulum and the nucleus. The pro-
death capabilities of the mitochondrion are controlled by three main factors: MPTP
INTRODUCTION
I
10
activity, increased reactive oxygen species (ROS) production, and impaired calcium
homeostasis.
I-3.2.1 Mitochondrial permeability transition
The mitochondrial permeability transition (MPT) is a pathophysiological relevant
mechanism that leads to increased permeability of the mitochondrial membranes and
participates in both necrotic and apoptotic cell death (Kim et al., 2003). The onset of
MPT is initiated by the opening of the nonspecific large-conductance MPTP, whereby the
inner mitochondrial membrane is permeabilized to solutes of up to 1.5 kDa, causing the
collapse of ∆Ψm. It is generally thought that a minimal MPTP is composed of VDAC
(voltage dependent anion channel in the outer mitochondrial membrane), ANT (adenine
nucleotide translocator in the inner mitochondrial membrane) and cyclophilin D (a prolyl
isomerase located in the matrix) (Crompton, 2000). Under normal conditions, both
VDAC and the ANT are involved in the delivery of ATP from the mitochondrial matrix
to the cytosol. The function of the prolyl isomerase cyclophilin D in the mitochondrial
matrix is still subject to investigation. However, under certain pathophysiological
conditions (e.g. high mitochondrial matrix calcium levels and/or enhanced oxidative
stress) these three proteins appear to be altered into forming the MPTP.
Interestingly, MPTP activation has been shown to occur upstream of Bax-
mediated cytochrome c release (De Giorgi et al., 2002; Precht et al., 2005). MPTP
activation may also amplify any cellular energetic crisis, as mitochondria become ATP
consumers, via ATP hydrolysis and reverse proton pumping by H+-ATPase (Leyssens et
al., 1996). In the heart, the MPTP has been implicated as an important factor mediating
I/R injury (Weiss et al., 2003). Both cyclosporin A (CsA) and sanglifehrin-A, inhibitors
of the MPTP, have been shown to prevent cardiac myocyte death caused by I/R in
perfused hearts (Borutaite et al., 2003; Hausenloy et al., 2003). Recently, in vivo studies
in cyclophilin D-null mice have confirmed the MPTP, or at least cyclophilin D, as a
mediator of I/R injury in the heart (Baines et al., 2005).
I-3.2.2 Mitochondrial ROS generation
Intimately linked to the mitochondrial role in PCD is their capability to generate ROS. In
the cardiac myocyte about 1-3% of the O2 that is normally reduced to H2O is converted to
INTRODUCTION
I
11
the superoxide anion (O2-˙), the upstream source of most ROS (Boveris et al., 1972). O2
-˙
production occurs by the constant slow transfer of electrons onto O2 at Complex I
(Turrens and Boveris, 1980) and the semiquinone radical of Complex III of the
mitochondrial electron transport chain (Turrens et al., 1985).
During I/R injury the return of oxygen to ischemic tissues is accompanied by an
increased production of ROS. Studies on whole hearts and isolated cells have shown that
a burst of ROS generation occurs during the first minutes after hypoxic and ischemic
tissues are reoxygenated (Zweier et al., 1987), due to the reactivation of mitochondrial
respiration (Ambrosio et al., 1993). ROS generation results in tissue lipid and protein
oxidation (Levraut et al., 2003) (Vanden Hoek et al., 1998). Antioxidant scavenging of
ROS blunts or eliminates I/R injury in vivo and in vitro (Vanden Hoek et al., 1997;
Calvillo et al., 2003; Adlam et al., 2005) and enhanced catalase expression via adenoviral
gene transfer decreased injury (Zhu et al., 2000), demonstrating that ROS play a
causative role in myocardial I/R injury.
I-3.2.3 Mitochondrial calcium handling
The cardiac myocyte requires an efficient supply and delivery of ATP from the
mitochondria to perform work and maintain ionic homeostasis. Calcium (Ca2+
), which is
stored in the sarcoplasmic reticulum (SR, specialized endoplasmic reticulum of muscle
cells) serves as a second messenger to couple mitochondrial ATP production to demand:
Ca2+
-release during the action potential (ionic exchanges at the plasma membrane which
mediate the contraction cycle) stimulates both actino-myosin ATPase activity
(contraction) and mitochondrial oxidative phosphorylation (Duchen, 2000) through
activation of the tricarboxylic acid cycle (Rizzuto et al., 2000). During the action
potential, a small amount of Ca2+
enters the cardiac myocyte through L-type channels in
the plasma membrane, triggering the large-scale release of sarcoplasmic reticulum Ca2+
stores into the cytosol (Bers, 2000). The ATP-dependent sarco/endoplasmic reticulum
calcium ATPase (SERCA), is then responsible for pumping Ca2+
from the cytosol back
into the SR during the relaxation phase (Dremina et al., 2004).
Decreased ATP production due to mitochondrial dysfunction during I/R results in
decreased SERCA activity: less Ca2+
is pumped back into the SR, leading to increased
cytosolic Ca2+
levels. The increased cytosolic Ca2+
levels may activate the Ca2+
-
INTRODUCTION
I
12
dependent calpain protease, which can activate the pro-apoptotic Bcl-2 family member
Bid (Chen et al., 2001). Furthermore, elevated cytosolic Ca2+
levels have been suggested
to lead to mitochondrial Ca2+
overload, which in turn would be causative in MPTP
opening and subsequent activation of apoptosis (Bagchi et al., 1997; Halestrap, 2006).
However, during simulated I/R in isolated adult cardiac myocytes, mitochondrial Ca2+
overload was found to be the consequence, rather than cause, of MPTP activation (Kim et
al., 2006), underscoring the importance of elucidating the events leading to mitochondrial
dysfunction.
I-3.3 Regulation of mitochondrial integrity by Bcl-2 family members
At the level of the single mitochondrion, both MPTP activity and the release of pro-
apoptotic proteins from the mitochondrial intermembrane space are regulated by two
opposing classes of the Bcl-2 (B-cell leukemia/lymphoma 2) family of death-regulating
proteins (Fig. 1). Members of the Bcl-2 protein family have either anti- or pro-apoptotic
functions (Reed et al., 1998) (Cory and Adams, 2002). Cellular stresses leading to the
execution of cell death pathways are perceived by Bcl-2 family proteins and
communicated to the mitochondria by regulated targeting of these proteins to the outer
mitochondrial membrane where they modulate the release of pro-apoptotic molecules
such as cytochrome c through interaction with other Bcl-2 family proteins. Bcl-2 family
proteins exert different activities as a function of their intracellular localization. Bcl-2
family members have also been shown to target membranes of the sarco-endoplasmatic
reticulum (S/ER), and the nuclear envelope where they excert additional/alternate pro- or
anti-apoptotic functions in part by regulating organelle calcium content and trafficking
events (Marin et al., 1996; Beham et al., 1997; Breckenridge et al., 2003; Xu et al.,
2005).
A common characteristic for all Bcl-2 family members is the presence of at least
one, and up to four, Bcl-2 homology (BH) domains (Fig. 2) which allow for the
formation of homo- or heterodimers between Bcl-2 proteins (Oltvai et al., 1993; Kelekar
and Thompson, 1998). The majority of Bcl-2 proteins furthermore possess a C-terminal
hydrophobic transmembrane (TM) domain for targeting to intracellular membranes, with
the exception of some BH3-only proteins.
INTRODUCTION
I
13
BH4BH4 BH3BH3 BH1BH1 BH2BH2 TMTM
BH3BH3 BH1BH1 BH2BH2 TMTM
BH3BH3 TMTM
anti-apoptotic
pro-apoptotic
BH3-only
subfamily
multidomain
subfamily
FIG. 2. Bcl-2 homology domains. Bcl-2 homology domains are a short stretch of sequences shared by the anti-apoptotic and pro-apoptotic Bcl-2 family of proteins. The anti-apoptotic Bcl-2 family members contain four Bcl-2 homology domains (BH1-BH4; e.g. Bcl-2, Bcl-xL). The pro-apoptotic Bcl-2 family can be further subdivided into the multidomain subfamily containing three Bcl-2 homology domains (BH1-BH3; e.g. Bak, Bax) and the BH3-only subfamily (BH3; e.g. Bid, Bnip3). In addition, most Bcl-2 proteins have a C-terminal hydrophobic transmembrane (TM) domain for targeting to intracellular membranes. Exceptions are found in the BH3-only subfamily (e.g. Bid).
I-3.3.1 Anti-apoptotic Bcl-2 family members
The anti-apoptotic members, including Bcl-2 and Bcl-xL, posses four Bcl-2 homology
domains (BH1-BH4) and potently inhibit apoptosis in various settings through the
sequestration of pro-apoptotic Bcl-2 family members via heterodimerization (Antonsson,
2004). Bcl-2 is always associated with intracellular membranes (i.e. the outer
mitochondrial membrane, S/ER and nuclear envelope) (Krajewski et al., 1993). Bcl-xL is
found in association with intracellular membranes and in addition exists in a soluble form
in the cytosol which translocates to the mitochondria during apoptosis (Wolter et al.,
1997). At the mitochondria both Bcl-2 and Bcl-xL have also been shown to stabilize the
MPTP and block the release of mitochondrial apoptogenic factors following cell death
stimuli (Susin et al., 1996). At the S/ER, Bcl-2 and Bcl-xL increase the permeability of
the S/ER to calcium, minimizing the Ca2+
signaling component of apoptosis (Chami et
al., 2004).
Anti-apoptotic Bcl-2 proteins have potent cardioprotective effects. Both Bcl-2
and Bcl-xL have been shown to protect against I/R injury in vivo (Brocheriou et al., 2000;
Imahashi et al., 2004; Huang et al., 2005). Gene transfer of Bcl-xL reduced cardiac cell
apoptosis following cold preservation and warm reperfusion of rat cardiac transplants
INTRODUCTION
I
14
(Huang et al., 2005). Furthermore, elevated Bcl-2 protein levels were reported to
coincide with the onset of protection during myocardial stunning (Depre et al., 2004).
I-3.3.2 Pro-apoptotic Bcl-2 family members
The pro-apoptotic members either contain three Bcl-2 homology domains (BH1-BH3;
e.g. Bax and Bak) or a single BH3 domain (‘BH3-only’; e.g. Bid and Bnip3). Bax and
Bid reside largely in the cytosol (or loosely bound to the mitochondria) and translocate to
the mitochondria following a pro-death stimulus (Wolter et al., 1997; Gross et al., 2004).
Once activated, Bax (Bcl-2 associated X protein) undergoes a conformational change,
allowing for its C-terminal end to be inserted into the mitochondrial outer membrane
(Goping et al., 1998; Nechushtan et al., 1999). Membrane insertion is followed by
oligomerization, an event thought to precede cytochrome c release (Shimizu et al., 1999;
Saito et al., 2000). It has been proposed that Bax, together with activated Bid, forms
channels directly via its oligomerization (Lim et al., 2002), regulate the pore size of the
VDAC to allow cytochrome c translocation (Shimizu et al., 1999) or cause membrane
instability to open lipidic channels (Degli Esposti, 2002).
The ‘BH3-only’ family member Bid (Bcl-2 interacting domain) lies within the
extrinsic death receptor pathway, and upon its activation serves to bridge the intrinsic and
extrinsic pathways. Following TNF-α or Fas treatment, Bid is cleaved by caspase 8
generating the C-terminal product tBid (truncated Bid), which is myristoylated and
translocates to the mitochondria (Zha et al., 2000). Bid can also be activated during
reperfusion by calpain cleavage (Chen et al., 2001). Bid has been proposed to both
directly participate in the mitochondrial outer membrane permeabilization event (Yuan
et al., 2003), as well as amplify the pro-apoptotic signaling of Bax either through direct
interaction with Bax/Bak (Saito et al., 2000; Wei et al., 2000), or through scavenging of
anti-apoptotic Bcl-2 and Bcl-xL, which oppose Bax activity (Wang et al., 1996; Cheng et
al., 2001). During I/R injury Bid and Bax play crucial roles in the commitment to cell
death, as demonstrated in both Bid (Peng et al., 2001) and Bax (Hochhauser et al., 2003)
knockout mice, where infarcts following I/R in the isolated heart were largely reduced.
Bnip3 (Bcl-2/adenovirus E1B 19 kDa interacting protein) is another member of
the ‘BH3-only’ Bcl-2 subfamily which has been described to induce apoptotic (Kubasiak
et al., 2002), necrotic (Vande Velde et al., 2000), and autophagic (Daido et al., 2004;
INTRODUCTION
I
15
Kanzawa et al., 2005) cell death. Bnip3 possesses a C-terminal transmembrane (TM)
domain which is required for its pro-apoptotic function, including targeting to the
mitochondria (Chen et al., 1997; Yasuda et al., 1998). Elevated Bnip3 protein levels
have been observed in vivo in an animal model of chronic heart failure (Regula et al.,
2002). Moreover, Bnip3 expression has been reported to be upregulated in neonatal
myocytes subjected to hypoxia, resulting in mitochondrial dysfunction and subsequent
cell death (Bruick, 2000; Kubasiak et al., 2002; Regula et al., 2002). Recently, our lab
has shown that Bnip3 contributes to I/R injury in the ex vivo heart via disruption of
mitochondrial integrity, leading to enhanced superoxide production and the release of
pro-apoptotic factors such as cytochrome c and AIF (Hamacher-Brady et al., 2006).
I-4 Autophagy – at the interface between death and survival
Autophagy (Greek for: ‘self-digestion’), is under normal conditions a process for the
turnover and recycling of long-lived macromolecules and organelles via the lysosomal
degradative pathway, involved in maintaining cellular homeostasis, differentiation, and
tissue remodeling. Paradoxically, under pathophysiological conditions, autophagy may
serve a protective role or contribute to cell damage. For example, nutrient depletion
classically induces autophagy in order to provide amino acids for the synthesis of
essential proteins, thus prolonging cell survival (Klionsky and Emr, 2000). Moreover,
autophagy may up to a certain threshold counteract apoptosis (PCD type I) (Boya et al.,
2005; Ravikumar et al., 2006). Other studies, however, have shown that autophagy can
act as a second type of programmed cell death, termed PCD type II (Yu et al., 2004;
Canu et al., 2005). Interestingly, autophagy shares common molecular regulators with
apoptosis, such as anti-apoptotic members of the Bcl-2 family proteins (Liang et al.,
1998; Shimizu et al., 2004), indicating a possible crosstalk between the two pathways.
I-4.1 Molecular mechanism of autophagy
Three main pathways lead to the lysosome via autophagy: macroautophagy,
microautophagy, and chaperone-mediated autophagy (Klionsky and Emr, 2000; Cuervo,
2004). During chaperone-mediated autophagy, proteins are delivered to the lysosome via
the chaperone Hsc73 (heat shock cognate protein 73) (Cuervo and Dice, 1996).
INTRODUCTION
I
16
Microautophagy describes the process whereby proteins are locally taken up by the
lysosome. Macroautophagy (hereafter referred to as autophagy), the most active form of
autophagy and a focus of this thesis, is a specific mode of autophagy in which isolation
membranes envelope a portion of the cytosol, containing non-specific cytosolic
components, selectively targeted toxic protein aggregates (Ravikumar et al., 2004),
intracellular pathogens (Gutierrez et al., 2004a), or organelles such as mitochondria (Xue
et al., 2001; Priault et al., 2005). The autophagosomes undergo a series of maturation
steps via fusion with endosomal vesicles and are then delivered to the lysosome, forming
the autophagolysosome, for subsequent degradation of their contents by lysosomal
proteases (Fig. 3).
Autophagosome
Lysosome
AutophagolysosomePhagophore
(1) (2) (3)
FIG. 3. Macroautophagy is a three-step process. (1) Macroautophagy first involves the sequestration of a region of the cytosol, containing proteins and/or organelles, which are engulfed by a newly formed double-membrane organelle, the autophagosomes. (2) To accomplish degradation of the autophagosomes and its cargo (●), the autophagosomes mature via fusion with endosomal vesicles and, subsequently, with the acidic lysosome, generating the autophagolysosome. (3) Within the autophagolysosome lysosomal proteases (▲) degrade the inner autophagosomal membrane and cargo.
I-4.1.1 Autophagosome formation
The autophagic process is initiated by the formation of an isolation membrane (or
phagophore), possibly derived from the S/ER (Juhasz and Neufeld, 2006), which engulfs
portions of the cytoplasm to generate a closed, double-membrane structure, the
autophagosome. Two ubiquitin-like conjugation systems which are well conserved
among eukaryotes are required for the formation of the autophagosome. One involves the
INTRODUCTION
I
17
attachment of Atg12 to Atg5 and the other the conjugation of phosphatidylethanolamine
to LC3/Atg8 (Fig. 4).
Atg12 is a modifier protein which is irreversibly conjugated to Atg5, independent
of autophagy induction (Mizushima et al., 1998a; Mizushima et al., 1998b). Atg7 (an
ubiquitin-activating E1-like enzyme) activates Atg12 in an ATP-dependent manner, by
binding to its C-terminal glycine. Subsequently, the C-terminal glycine of Atg12 is
transferred to Atg10 (an ubiquitin-conjugation E2-like enzyme). Atg10 in turn activates
the conjugation of Atg12 C-terminal glycine to Atg5 lysine 130. Atg16 dimerizes and
forms a complex with a pair of Atg12-Atg5 and this complex evenly associates with the
crescent shaped phagophore. Curvature is thought to be introduced via subsequent
asymmetrical redistribution of the Atg12-Atg5.
Atg16 complex mainly to the convex
surface of the phagophore. Upon completion of autophagosomes formation, Atg12-
Atg5.
Atg16 complexes dissociate from the membrane (George et al., 2000) and are not
present in the mature autophagosome. Atg12-Atg5 conjugation is indispensable for the
involvement of Atg5 in the elongation of the initial phagophore (Mizushima et al., 2001).
The development of the phagophore into the autophagosome requires the
cooperation of microtubule-associated protein light chain 3 (LC3/Atg8) (Tanida et al.,
2004). LC3 is synthesized as a cytosolic full-length precursor protein which is converted
into LC3-I via cleavage by the cysteine protease Atg4, exposing its C-terminal glycine
residue (Kirisako et al., 2000). The glycine residue is then activated by Atg7 (E1-like) in
an ATP-dependent manner, transferred to Atg3 (E2-like), and finally conjugated to the
phospholipid phosphatidylethanolamine (PE) through an amide bond (Marino, Uria et al.
2003). LC3-PE (or LC3-II) is then recruited to the autophagosomal membrane in an
Atg5-dependent manner (Mizushima et al., 2001; Kabeya et al., 2004), a process that is
required for the execution of autophagy (Kirisako et al., 2000). A lysine-130-arginine
(K130R) mutation of Atg5 prevents binding of Atg12 without interfering with membrane
targeting of Atg5 (Mizushima et al., 1998b; Pyo et al., 2005). Importantly, Atg5(K130R)
is unable to recruit LC3 and results in failed phagophore maturation. As opposed to
Atg12-Atg5, LC3-II is present in the early phagophores and matured autophagosomes
where it ultimately is degraded by lysosomal proteases (Kirisako et al., 1999). Atg4 can
deconjugate PE from LC3-II located in the outer autophagosomal membrane, converting
INTRODUCTION
I
18
it back to cytoplasmic LC3-I (Kabeya et al., 2004), although most LC3-II is degraded by
the lysosome (Tanida et al., 2005). The C-terminal end of LC3 is acting as an interface
for interacting with autophagosomal membranes, while its amino-terminal end is required
for its binding to tubulin and microtubules (Kouno et al., 2005). Coupled to GFP, LC3
serves as a specific and unique fluorescent marker for autophagosomal structures
(Mizushima et al., 2004).
Atg16
Atg16
LC3-II
Atg12
Atg12
Atg5Atg12
Atg5
LC3-II
PE
LC3-II formation
LC3-I
E1
E2
Atg7
Atg3
Atg4
Atg12
Atg5
Atg7E1
E2 Atg10
Atg12
Atg5
Atg12-Atg5 conjugation
Elongation Sequestration
Autophagosome
LC3-II
LC3-II
Phagophore
LC3-II
LC3-I
LC3
Atg4
Atg16Atg5
Atg16
Atg5Atg12
Atg16
Atg16
Atg12
Atg5Atg12
Atg5
FIG. 4. Two ubiquitin-like conjugation systems during autophagosome formation. Atg12 and LC3/Atg8 are ubiquitin-like proteins which during autophagosome formation are conjugated to Atg5 and PE, respectively. Atg12 is activated and bound by E1-like Atg7, transferred to E2-like Atg10, and conjugated to Atg5. Homodimers of Atg16 bind a pair of Atg12-Atg5 conjugates and this complex transiently associates with the forming autophagosomal membrane. The membrane-bound Atg12-Atg5
.Atg16 complex is a prerequisite for the recruitment of LC3-II, which
is the product of the second ubiquitin-like conjugation. Initially, the cysteine protease Atg4 removes the C-terminal arginine residue of cytosolic LC3, generating LC3-I with a revealed glycine residue. LC3-I is then activated by E1-like Atg7, transferred to E2-like Atg3, and conjugated to PE. The resulting LC3-II is recruited into the forming autophagosomal membrane. After completion of autophagosomes formation, a second cleavage by Atg4 results in some removal of PE from LC3-II, reverting it back into LC3-I which is released from the membrane. The remaining membrane-attached LC3-II is degraded by lysosomal proteases.
INTRODUCTION
I
19
I-4.1.2 Autophagosome maturation
Following the completion of autophagic sequestration, the autophagosome undergoes a
series of maturation steps prior to its fusion with the lysosome. During the multi-step
maturation process, autophagosomes fuse with endosomal vesicles and protease-
containing late endosomal compartments and finally, lysosomes (Gordon et al., 1992
1992; Dunn, 1994).
These fusion events are mediated in part by a family of Rab GTPases, known
mediators of vesicular trafficking, whose functions include vesicle formation, motility,
and tethering to their target compartment (Zerial and McBride, 2001). Upon membrane
fusion, Rab-bound GTP is hydrolyzed to GDP, and inactive Rab-GDP is bound by a Rab
GDP-dissociation
inhibitor (RabGDI), removing Rab to its original membrane
compartment. Rab7 is a key component in the regulation of autophagosomal maturation:
overexpression of a dominant negative mutant of Rab7 has been shown to inhibit fusion
between autophagosomes and the late endosome/lysosomal compartment (Gutierrez et
al., 2004b; Jager et al., 2004). Lysosomal receptor protein Lamp2 is involved in Rab7-
mediated fusion of autophagosomes and lysosomes as RNAi knockdown results in
retarded recruitment of Rab7 to autophagosomal membranes (Jager et al., 2004), and the
accumulation of autophagosomes (Eskelinen et al., 2004; Gonzalez-Polo et al., 2005b).
Also the cytoskeleton also regulates autophagosome formation as well as
endosomal and lysosomal trafficking (Aplin et al., 1992). Pharmacologic inhibition of
microtubules with nocodazole blocks fusion between autophagosomes and lysosomes,
evidencing its role in autophagosomal formation and delivery (Kochl et al., 2006).
Autophagy is furthermore dependent on intermediate filaments (Blankson et al., 1995).
I-4.1.3 Degradation within the autophagolysosome
The autophagosome acquires the milieu and enzymes necessary for the degradation of its
cargo through fusion with the lysosome. The lysosome is a membrane-bound organelle
which contains a cocktail of predominantly hydrolytic enzymes that are maximally active
at low pH (e.g. cathepsins B and D which degrade proteins, lipids, nucleic acids, and
polysaccharides). Acidification of the lysosomal lumen is accomplished by the vacuolar
H+-ATPase (v-ATPase), which hydrolyses cytosolic ATP to translocate H
+ into the
lysosomal lumen (Sun-Wada et al., 2003). Lysosomal transport
proteins such as
INTRODUCTION
I
20
cystinosin are thought to mediate the recycling of degraded products (amino acids,
sugars, and nucleotides) from the lysosome back to the cytosol (Winchester, 2001),
hereby completing the catabolic process.
I-4.2 Regulation of autophagy
Two pathways, which are conserved among eukaryotes, are involved in regulating
autophagic activity at the level of induction: one involves class I phosphatidylinositol 3-
kinase (PI3-K), which suppresses autophagy, and the other activation of autophagy by
class III PI3-K (Fig. 5).
I-4.2.1 Negative regulation of autophagy
Autophagy is suppressed by the class I PI3-K/Akt pathway (Petiot et al., 2000), which is
involved in anabolic metabolism (Chang et al., 2004; Hanada et al., 2004). Within this
pathway mTOR (mammalian target of rapamycin) is a central downstream effector
kinase which mediates the cellular response to nutrients, amino acids and mitogens
(Schmelzle and Hall, 2000). In the presence of amino acids and growth factors, mTOR
activates the p70S6 kinase (p70S6K), which phosphorylates the ribosomal protein S6,
resulting in the upregulation of the translational machinery. In addition, mTOR
phosphorylates and thereby deactivates the initiation factor 4E-BP1 (4E binding protein).
Deactivated 4E-BP1 then dissociates from the initiation factor eIF4E which is the rate-
limiting step in protein synthesis. Inhibiting mTOR activity with the immunosuppressant
rapamycin (Blommaart et al., 1995) increases the catabolic process of autophagy, even in
the presence of nutrients (Noda and Ohsumi, 1998). The negative control of mTOR over
autophagy is a generally accepted phenomenon (Shintani and Klionsky, 2004), however,
the underlying mechanism is largely unknown.
I-4.2.2 Positive regulation of autophagy
Beclin1/Atg6, the first mammalian protein described to mediate autophagy (Liang et al.,
1999), is a coiled-coil, myosin-like Bcl-2-interacting protein which engages class III PI3-
K/Vps34 to positively regulate autophagy (Kihara et al., 2001a; Zeng et al., 2006).
Beclin1 has been shown to colocalize with the S/ER, mitochondria (Liang et al., 2001),
and Golgi (Kihara et al., 2001a). Typically all Beclin1 forms a complex with Vps34,
whereas ~50% of Vps34 is not associated with Beclin1 (Kihara et al., 2001a). The
INTRODUCTION
I
21
specific product of Vps34, phosphatidylinositol 3-phosphate (PI3-P), is a lipid second
messenger which mediates the formation of autophagosomes (Schu et al., 1993; Petiot et
al., 2000). Furthermore, the yeast homologues of Beclin1 and Vps34 have been shown to
mediate intracellular vesicle trafficking, including endosomes and transport of lysosomal
proteases from the Golgi to the lysosome (Kihara et al., 2001b; Obara et al., 2006).
However, in mammalian cells the role of Beclin1-Vps34 in trafficking and protein sorting
remains controversial (Kihara et al., 2001a; Row et al., 2001; Obara et al., 2006).
Beclin 1
Class III PI3-K
mTOR
Class I PI3-K
Lysosome
Autophagolysosome
(3) (4)
(1)
(2)
AutophagosomePhagophore
PI3-P
Rab7Atg12-Atg5.Atg16
LC3-II
LC3-I
PE
Rapamycin
FIG. 5. Molecular mechanism and regulation of autophagy. (1) Induction of autophagy requires activity of Beclin1 and its interacting partner, class III PI3-K (Vps34), resulting in the generation of PI3-P; and it is negatively regulated by class I PI3-K through mTOR. (2) Formation of the phagophore requires conjugation of Atg12 to lysine 130 of Atg5 as a prerequisite for recruiting LC3-II. (3) Sequestration of cytoplasmic material may be nonspecific or selective; mechanisms that may govern selectivity are incompletely understood. (4) Degradation of the autophagosomes and its cargo is accomplished after sequential fusion events with endosomes and finally lysosomes. Transport and fusion events are mediated by Rab GTPases, with Rab7 being a major player in autophagy. Beclin1-Vps34 activity might further be involved in lysosomal protein sorting (not shown).
I-4.3 Cross-talk of autophagy and apoptosis: Bcl-2 family members
Interest in autophagy is at present increasing, due in part to the recognition of its
involvement in caspase-independent PCD (PCD type II) and its interaction with
components of the apoptotic death pathway (PCD type I) (Saeki et al., 2000; Yanagisawa
et al., 2003; Shimizu et al., 2004).
INTRODUCTION
I
22
I-4.3.1 Anti-apoptotic Bcl-2 family members
Beclin1 was initially identified as a Bcl-2 interacting protein using a yeast two-hybrid
screen (Liang et al., 1998). Following, it was established that the Bcl-2 binding domain
of Beclin1 serves as a point of crosstalk between the autophagic and apoptotic pathways,
at the level of autophagy induction. Interestingly, it seems that only anti- but not pro-
apoptotic Bcl-2 family members can interact with this domain (Liang et al., 1998). Bcl-2
downregulation has been shown to increase autophagy in HL60 cells (Saeki et al., 2000),
while overexpression of Bcl-2 or Bcl-xL increased the autophagic response to etoposide
treatment in MEF cells (Shimizu et al., 2004). Recently, Bcl-2 was shown to suppress the
autophagic response to starvation (Pattingre et al., 2005). Clearly, the nature of the
relationship is not yet fully understood and merits further investigation. It is likely that
the regulation of autophagy through Bcl-2 is a function of both cell type and stimulus.
I-4.3.2 Pro-apoptotic Bcl-2 family members
The BH3-only proteins Bid and Bnip3 also constitute a point of crosstalk between the
apoptotic and autophagic pathways. Bid can be activated by lysosomal cathepsin
proteases which are released into the cytosol during some forms of PCD (Stoka et al.,
2001; Cirman et al., 2004). Moreover, Bid itself has recently been shown to cause
destabilization of lysosomes and release of cathepsin B (Werneburg et al., 2004;
Guicciardi et al., 2005), forming an amplification event for mitochondrial apoptosis. In
MCF-7 cells exposed to camptothecin, RNAi silencing of Bid inhibited apoptosis and
enhanced autophagy, suggesting that Bid may function as a ‘switch’ between the
different modes of PCD (Lamparska-Przybysz et al., 2005).
Upregulation of Bnip3 has been shown to correlate with ceramide-induced
accumulation of autophagosomes in malignant glioma cells (Daido et al., 2004).
Similarly, arsenic trioxide-induced PCD correlated with elevated levels of Bnip3 and
enhanced presence of autophagosomal structures (Daido et al., ; Kanzawa et al., 2005).
Furthermore, in these studies expression of the dominant-negative transmembrane
domain deletion mutant of Bnip3 prevented the observed changes in autophagy, while
overexpression of Bnip3 was sufficient to induce increased steady-state levels of
autophagosomes in the absence of ceramide or arsenic trioxide. The authors concluded
INTRODUCTION
I
23
that ceramide- and arsenic trioxide-induced Bnip3-mediated PCD is autophagic, however
a causative role of autophagy in cell death was not established.
I-4.4 Autophagy in the heart
Autophagy is a vital process in the heart, presumably participating in the removal of
dysfunctional cytosolic components, and serving as a catabolic energy source during
times of starvation. For example, autophagy in cardiac myocytes has been suggested to
provide a necessary source of energy between birth and suckling (Kuma et al., 2004), and
in a GFP-LC3 transgenic mouse, cardiac myocytes from starved animals displayed high
numbers of autophagosomes, some of which contained mitochondria (Mizushima et al.,
2004).
Impaired autophagy may play a causative role in cardiac disease. Incomplete
autophagic turnover of ‘old’ mitochondria may be the source of lipofuscin, a toxic waste
product which builds up during the lifespan (Brunk and Terman, 2002). Danon disease,
is caused by decreased levels of Lamp2 (Saftig et al., 2001; Horvath et al., 2003), a
lysosomal receptor which mediates the fusion process between autophagosomes and
lysosomes (Gonzalez-Polo et al., 2005a). Recently it was shown that Danon disease-
related cardiomyopathy develops as a result of extensive vacuolization in cardiac
myocytes and interference with the contractile function (Stypmann et al., 2006).
Furthermore, disruption of the autophagic pathway may contribute to myocardial cell
death under conditions where lysosomal integrity is lost and lysosomal proteases are
released into the cytosol (Decker et al., 1980).
Importantly, autophagy may serve as a protective response to myocardial I/R
injury, as increased prevalence of autophagosomes has been documented in response to
sub-lethal ischemia in the perfused heart (Decker et al., 1980). Moreover, it was recently
reported that in an in vivo model of myocardial stunning the onset of protection correlated
with increased Beclin1 expression (Yan et al., 2005). Controversially, other correlative
studies indicate that autophagic cell death (PCD type II) occurs in the failing heart.
Autophagosomes are widely reported to be increased in heart disease (Knaapen et al.,
2001; Shimomura et al., 2001; Saijo et al., 2004; Miyata et al., 2006), and in response to
myocardial hibernation (Elsasser et al., 2004) and Diphtheria toxin-activated myocardial
cell death (Akazawa et al., 2004).
INTRODUCTION
I
24
I-5 Thesis objectives
Enhancing survival of cardiac tissues following I/R is a crucial goal in cardiovascular
research. One characteristic of myocardial I/R injury is the prevalence of
autophagosomes. However, the role of autophagy in this pathophysiology is unclear.
Two hypotheses are proposed here:
(1) Autophagy functions as a cytoprotective mechanism to oppose I/R injury.
(2) The protection exerted by autophagy is in part due to the degradation of
malfunctioning mitochondria.
Thus, overall goal of this body of work was to quantify the relationship between
I/R-activated mitochondrial death pathways and autophagy. To do so we sought to
systematically perturb the apoptotic and autophagic signaling pathways, in order to
determine and quantify cause and effect. High-resolution fluorescence imaging was
employed as the main tool as it allows spatial and temporal detection of events in the
single live cell.
I-5.1 Cell culture model of I/R injury to the heart
A cell-based model of I/R is a prerequisite for studies aimed at elucidating signaling
pathways in myocardial I/R injury. However, for our purposes to date no satisfactory
model existed that combined high comparability to the in vivo situation with the high
capacity for manipulation of cell culture models. Thus, the goal of Chapter III was to
develop a unique model for studying the multiple pathways during I/R injury. Using the
recently established cardiac cell line HL-1, which is novel in its high degree of molecular
and physiological similarity to the adult cardiac myocyte, the spatio-temporal dynamics
of mitochondrial dysfunction, and the activities pro-apoptotic Bcl-2 family members Bax
and Bid were studied to establish quantifiable parameters of pro-death signaling leading
to mitochondrial dysfunction in I/R.
I-5.2 Elucidation of the regulation of Beclin1-mediated autophagy
To date the nature of control of anti-apoptotic Bcl-2 family members over Beclin1-
mediated autophagy is unclear. In part this is due to incorrect use of tools available for
detecting the autophagic response. The goal of Chapter IV was to develop a method for
the specific and quantitative assessment of macroautophagic activity, and subsequently to
INTRODUCTION
I
25
determine how Beclin1-mediated autophagy is regulated by Bcl-2 in the HL-1 cardiac
myocyte.
I-5.3 Role of Beclin1-mediated autophagy in myocardial I/R injury
To date studies on the role of autophagy in the heart are correlative and it remains to be
determined if, and under which conditions, autophagy represents a protective or
detrimental cellular mechanism. Using the our established model of I/R injury in HL-1
cells together with the techniques developed for investigating autophagy, the goal of
Chapter V was to elucidate the role of Beclin1-mediated autophagy in cardiac I/R injury.
The goal of Chapter IV through pharmacologic and molecular approaches while
monitoring the effect on cellular injury.
I-5.4 Connection between mitochondrial dysfunction and autophagy
Bnip3 is a pro-apoptotic Bcl-2 protein which contributes to myocardial I/R injury by
causing mitochondrial dysfunction. On the premise that mitochondrial dysfunction plays
a key role in I/R injury and autophagy is capable of scavenging damaged mitochondria,
we hypothesized that during I/R, Bnip3 promotes autophagy of malfunctioning
mitochondria. The goal of Chapter VI was to investigate the connection between I/R
injury, Bnip3-induced mitochondrial dysfunction, and mitochondrial autophagy in the
HL-1 cardiac myocyte.
Chapter 2
Materials and Methods
________________________________________________________________________
MATERIALS & METHODS
II
29
II-1 Materials
Reagents for the production of solutions, buffers, and media were purchased from Sigma-
Aldrich (St. Louis, MO, USA). Materials for HL-1 cell culture were obtained from JRH
Biosciences (Lenexa, KS, USA), BD Biosciences (San Jose, CA, USA), and Sigma-
Aldrich. Pharmacologicals were purchased from EMD Biosciences (La Jolla, CA,
USA). Fluorescent dyes were obtained from Invitrogen (Carlsbad, CA, USA).
Antibodies were obtained from Abcam (Cambridge, MA, USA), BD Biosciences -
Clontech (Mountain View, CA, USA), Caltag (Burlingame, CA, USA), R&D Systems
(Minneapolis, MN, USA), Santa Cruz (Santa Cruz, CA, USA), and Sigma-Aldrich.
Materials for Western blotting were purchased from Bio-Rad (Hercules, CA, USA) and
Pierce (Rockford, IL, USA). Kits and enzymes for DNA techniques and transfection
reagents were purchased from Qiagen (Valencia, CA, USA), New England Biolabs
(Ipswich, MA, USA), Stratagene (La Jolla, CA, USA), and Invitrogen. Consumables
were bought via Fisher Scientific (Tustin, CA, USA) from the following suppliers:
Corning (Corning, NY, USA), and BD Biosciences. Pipet-tips were from Myriad (San
Diego, CA, USA). Glass-bottom microwell dishes were obtained from MatTek
(Ashland, MA, USA).
II-1.1 Antibodies
II-1.1.1 Primary antibodies
Antibody against Description Source
Actin clone AC-40; mouse monoclonal Sigma-Aldrich
Atg5 3H2201; chicken polyclonal Abcam
Bcl-2 C-2; mouse monoclonal Santa Cruz
Bcl-xL H-5; mouse monoclonal Santa Cruz
Beclin1 D-18; goat polyclonal Santa Cruz
Bid rat monoclonal R&D Systems
Bnip3 mouse monoclonal Sigma-Aldrich Drp1 (= Dlp1) mouse monoclonal BD Biosciences
Fluorescent Protein mouse monoclonal BD Biosciences
RhoGDI mouse monoclonal BD Biosciences
MATERIALS & METHODS
II
30
II-1.1.2 Horseradish peroxidase-conjugated secondary antibodies
Description Source
Goat anti-mouse IgG (H+L) Caltag
Goat anti-rabbit IgG (H+L) Caltag
Swine anti-goat IgG (H+L) Caltag
Goat anti-rat IgG (H+L) Caltag
Rabbit anti-chicken IgY (H+L) Abcam
II-2 Methods
II-2.1 Cloning and plasmid construction
The DNA sequences of interest were amplified from the indicated template via PCR
(polymerase chain reaction) (Mullis et al., 1986) using primers (listed in the appendix: X-
2) containing restriction sites according to the MCS (multiple cloning site) of the vector
(Scharf et al., 1986). Primer design was done using the nucleic acid analysis and
modeling tools of the web-based SDSC Biology Workbench
(http://workbench.sdsc.edu/). All primers where synthesized by Allele Biotech (San
Diego, CA, USA).
Standard PCR reaction mix1:
5 ng Template
0.5 µM each Oligonucleotides (‘primer’)
250 µM Desoxynucleotides (dNTPs)
1X Pfu DNA Polymerase Reaction Buffer
1 µl PfuTurbo DNA Polymerase (Stratagene) 1 final volume: 40 µl per reaction, adjusted with MilliQ-H2O.
Standard PCR program:
Cycle Reaction Temperature Duration Loops
1 (Lid heat) 110°C
2 Denaturing 95°C 1:00 min 1 x
3 Denaturing 95°C 1:00 min
Annealing 54°C 0:30 min 30 x (Cycle 3)
Synthesis 72°C 1:00 min
4 “Fill-in” 72°C 10:00 min 1 x
5 Reaction stop 4°C forever
MATERIALS & METHODS
II
31
Subcloning of PCR products into mammalian expression vectors was performed using
standard methods of molecular biology (CPMB). PCR products were purified by size-
separation on 1% (w/v) agarose gels and subsequent QIAEX II gel extraction (Qiagen).
Following, both vector and PCR-products were digested with the appropriate restriction
enzymes. After gel purification, vector and PCR-products were ligated using T4 DNA
ligase (Invitrogen). The obtained plasmids were transformed into bacteria of the
Escherichia coli strain DH5α (Invitrogen) for amplification. Transformed bacteria were
selected with the help of vector-encoded antibiotic resistance. Plasmid DNA was
purified from DH5α over-night cultures using the QIAprep Miniprep kit (Qiagen) and
sequence verified (TSRI DNA core lab). Vector maps were generated using pDraw32
DNA analysis freeware (AcaClone software, http://www.acaclone.com/) and gathered in
the appendix (X-6).
II-2.1.1 pmCherry-C1
mCherry was amplified from the pRSET-mCherry vector (Shaner et al., 2004), with the
forward (5’-GTAACCGGTATGGTGAGCAAGGGCGAG-3’) and reverse (5’-
GTAAGATCTCTTG TACAGCTCGTCCATGC-3’) primers. AgeI and BglII restriction
sites (underlined) were added to 5’ and 3’ cDNA ends, respectively. mCherry was
swapped with EGFP of the vector pEGFP-C1, generating the pmCherry-C1 vector.
II-2.1.2 mCherry-Bax
Human Baxα was amplified from pEGFP-Bax (Wolter et al., 1997), with the forward (5’-
GTAAGATCTATGGACGGGTCCGGGGAG-3’) and reverse (5’-
GTAGAATTCTCAGCCCACT TCTTCCAGATGGTG-3’) primers BglII and EcoRI
restriction sites (underlined) were added to 5’ and 3’ cDNA ends, respectively. Human
Baxα was inserted into pmCherry-C1 at the BglII and EcoRI restriction sites.
II-2.1.3 Mito-ECFP
ECFP was excised from pECFP-N1 at restriction sites BamHI and NotI. DsRed2 was
removed from the mito-pDsRed2 vector (Clonetech) at restriction sites BamHI and NotI,
and replaced with ECFP to generate the mito-ECFP vector.
MATERIALS & METHODS
II
32
II-2.1.4 YFP-Bid-CFP
YFP-Bid-CFP was generated using the improved versions of YFP, Venus (Nagai et al.,
2002), and CFP, Cerulean (Rizzo et al., 2004). Human full-length Bid, Venus, and
Cerulean were amplified by PCR using end primers containing the required restriction
sites to generate (KpnI)YFP-(XhoI)-Bid-(SphI)-CFP(NotI). The obtained ligation product
was subcloned into pcDNA3.1(+) using the KpnI and NotI sites.
II-2.1.5 mCherry-Atg5
Atg5 cDNA was amplified from mouse cDNA library (Invitrogen) with the forward (5’-
GTACTCGAGGGATGACAGATGACAAAGATGTG-3’) and reverse (5’-
GTAGGATCCATCTGTTGGCTGGGGGAC-3’) primers. Primers were designed to
remove the stop codon and add XhoI and BamHI restriction sites (underlined) to 5’ and 3’
ends, respectively. Atg5 was then ligated into pmCherry-C1 vector at the XhoI and
BamHI restriction sites.
II-2.2 Site-directed mutagenesis
Site-directed mutagenesis was employed to investigate the role of specific proteins in
autophagy and apoptosis. The desired mutations were inserted into wild-type cDNA by
PCR, using two complementary oligonucleotides containing the altered codon (Higuchi
et al., 1988; Weiner et al., 1995). Template cDNA encoding the gene of interest was
amplified by PCR using the restriction site-containing primers used for the amplification
and cloning of wild-type constructs (II-2.1). To insert the mutation, two PCR reactions
were performed, amplifying the 5’template end with the 5’Forward primer and 3’Reverse
mutant primer, and amplifying the 3’template end with the 5’Forward mutant primer and
3’Reverse primer. The PCR products were separated on 1% (w/v) agarose gels and
extracted using the QiaQuick Gel Extraction Kit (Qiagen). Another PCR was performed
on the purified 5’ and 3’ ends. During PCR, the overlapping segments corresponding to
the mutant primer sequences, anneal and the DNA polymerase extends the 3’ ends to
generate full length cDNA. The reaction was then spiked with template 5’Forward and
3’Reverse primers to amplify the cDNA containing the desired mutation.
MATERIALS & METHODS
II
33
II-2.2.1 mCherry-BaxT182A
The threonine 182 to alanine (T182A) point mutation within human Baxα was generated
using site directed mutagenesis. The T182A mutation was inserted using the forward
primer 5'-GGGAGTGCTCGCCGCCTCACTCACCATCTGG-3' and its complementary
reverse primer 5'- CCAGATGGTGAGTGAGGCGGCGAGCACTCCC-3'. The construct
was inserted into the pmCherry-C1 vector.
II-2.2.2 YFP-Bid∆casp8-CFP
To generate YFP-Bid∆casp8-CFP, wild-type Bid in YFP-Bid-CFP was exchanged
against Bid∆casp8 which had previously been obtained via site directed mutagenesis of
the caspase 8 cleavage site generating a aspartic acid 60 to glutamic acid (D60E) point
mutation using the forward primer 5’-GAGCTGCAGACTGAGGGCAACCGCAGC
AGC-3’ and the complementary reverse primer 5’-GCTGCTGCGGTTGCCCTCAGTCT
GCAGCTC-3’.
II-2.2.3 mCherry- Atg5K130R
The lysine 130 to arginine (K130R) point mutation within mour Atg5 was inserted using
site directed mutagenesis as previously described (Mizushima et al., 2001), using the
forward primer 5’-GTCGTGTATGAGAGAAGCTGATG-3’ and the complementary
reverse primer 5’- CATCAGCTTCTCTCATACACGAC-3’. Atg5K130R
was then ligated
into pmCherry-C1 vector at the XhoI and BamHI restriction sites.
II-2.3 RNA interference
Silencing of Bnip3 and Beclin1 was achieved using the vector-based RNAi system
BLOCK-iT™ Pol II miR RNAi Expression Vector Kit (Invitrogen). The vector
pcDNA™6.2-GW/EmGFP-miR embeds a small hairpin RNA within a microRNA fold,
which is then processed by the endogenous RNAi machinery (Amarzguioui et al., 2005).
Sequences with 100% homology to regions within the ORF (open reading frame) of the
gene of interest were generated using the BLOCK-iT™ RNAi Designer
(https://rnaidesigner.invitrogen.com/rnaiexpress). The obtained target sequences were
checked for the absence of significant homology to other proteins within the respective
species using BLAST analysis (Altschul et al., 1990). The sequence was used to generate
homologous oligonucleotide pairs (Allele Biotech; San Diego, CA, USA), which were
MATERIALS & METHODS
II
34
inserted into the pcDNA™6.2-GW/EmGFP-miR, which has co-cistronic expression of
EmGFP, allowing for determination of transfection efficiency by fluorescence
microscopy. The obtained vectors were sequence verified. To control for non-specific
RNAi effects, the construct pcDNA™6.2-GW/EmGFP-miR-LacZ (targeting beta
galactosidase) was used as control.
II-2.3.1 Bnip3
The obtained target sequence for the ORF of mouse Bnip3 was 5’-
TCCAGCCTCCGTCTCTATTTA-3’ (78-98) and showed no significant homology to
other mouse proteins. The generated oligonucleotide pairs were used to generate
pcDNA™6.2- GW/EmGFP- miR-Bnip3(78). For silencing of Bnip3, HL-1 cells were
transfected using Lipofectamine 2000. Cell lysates were prepared 48 h after transfection
and Bnip3 protein levels were assessed via Western blotting (II-2.14).
II-2.3.2 Beclin1
The obtained target sequences for the ORF of mouse Beclin1, 5’-
TGAAACTTCAGACCCATCTTA-3’ (a) and 5’-TAATGGAGCTGTGAGTTCCTG-3’
(b), showed no significant homology to other mouse proteins and were used to generate
pcDNA™6.2-GW/EmGFP-miR-Beclin1(a) and –Beclin1(b). Cells were co-transfected
with both vectors using Lipofectamine 2000 to achieve maximal knock-down of Beclin1.
96 h after transfection, Beclin1 protein levels were assessed via Western blotting.
II-2.4 Cell culture
Cells of the atrial-derived cardiac cell line HL-1 (Claycomb et al., 1998) were plated in
gelatin/fibronectin-coated culture vessels and maintained in Claycomb medium (JRH
Biosciences) supplemented with 10% fetal bovine serum, 0.1 mM norepinephrine, 2 mM
L-glutamine, 100 U/ml penicillin, 100 U/ml streptomycin, and 0.25 µg/ml amphotericin
B. Cells were passaged at 1:3 every two days and cells of the passages 70 to 80 were
used for experiments. For fluorescence microscopy, cells were plated on 25-mm-
diameter round glass coverslips (Fisher Scientific) or in the center of 14-mm-diameter
glass bottom microwell dishes (MatTek). For Western blotting, cells were plated in 6-
well-plates or 60-mm diameter dishes.
MATERIALS & METHODS
II
35
II-2.5 Transfections
Cells, which had been plated the day before, were transfected with the indicated vectors
using the transfection reagents Effectene (Qiagen) or LipofectamineTM
2000 (Invitrogen).
The manufacturer’s protocols for adherent cells were optimized for HL-1 cells achieving
on average ~40% and ~60% transfection efficiency, respectively, without detectable
toxicity.
II-2.5.1 Effectene transfection protocol
MatTek format 6-well format 60-mm format
# of cells plated 35 000 150 000 300 000
DNA 0.3 µg 0.9 µg 1.5 µg
EC buffer 65 µl 195 µl 300 µl
Enhancer 3.75 µl 10 µl 20 µl
Effectene 2.5 µl 7.5 µl 13 µl
Medium (per mix) 390 µl 600 µl 1.2 ml
Medium (per dish) 1.0 ml 1.6 ml 3 ml
The DNA was diluted in EC buffer and incubated for 5 min following addition of
Enhancer. Then, the non-liposomal lipid reagent Effectene was added and the mixture
was incubated for an additional 10 min. Fully supplemented (containing serum and
antibiotics) Claycomb medium was added and the transfection complexes were
immediately added to cells cultured in fully supplemented Claycomb medium. Medium
was exchanged after 16-24 h.
II-2.5.2 Lipofectamine transfection protocol
MatTek format 6-well format 60-mm format
# of cells plated 80 000 600 000 120 000
DNA 2.4 µg 4 µg 8 µg
+ OPTI-MEM 150 µl 250 µl 0.5 ml
LipofectamineTM
2000 3 µl 5 µl 10 µl
+ OPTI-MEM 150 µl 250 µl 0.5 ml
Medium (per dish) 1.2 ml 2 ml 5 ml
The DNA was diluted in serum-free OPTI-MEM (Invitrogen). The cationic lipid reagent
Lipofectamine 2000 was likewise diluted in serum-free OPTI-MEM and incubated for 5
min at room temperature. Following, DNA and Lipofectamine dilutions were combined
and incubated for 20 min at room temperature. Lipofectamine-DNA complexes were
MATERIALS & METHODS
II
36
added to cells cultured in antibiotic-free serum-containing Claycomb medium. The
medium was replaced after 5-8 h with fully supplemented Claycomb medium.
II-2.6 High and low nutrient condition
For high nutrient conditions, experiments were performed in fully supplemented
Claycomb medium. For low nutrient conditions, experiments were performed in Krebs-
Henseleit solution (KH, in mM: 110 NaCl, 4.7 KCl, 1.2 KH2PO4, 1.25 MgSO4, 1.2
CaCl2, 25 NaHCO3, 15 glucose, 20 HEPES, pH 7.4).
II-2.7 Simulated ischemia/reperfusion (sI/R)
For real-time fluorescence imaging, cells were plated on 25-mm-diameter round glass
coverslips. The coverslips were placed in an air-tight Leiden perfusion chamber
(Harvard Apparatus; Holliston, MA, USA), mounted on the stage of a fluorescence
microscope and subjected to 1-2 h of simulated ischemia by superfusion with ischemia-
mimetic solution (in mM: 125 NaCl, 8 KCl, 1.2 KH2PO4, 1.25 MgSO4, 1.2 CaCl2, 6.25
NaHCO3, 5 Na-lactate, 20 HEPES, pH 6.6) equilibrated with 95% N2-5% CO2, followed
by reperfusion with normoxic KH solution equilibrated with 95% O2-5% CO2.
Alternatively, cells were plated in MatTek dishes and ischemia was introduced by
a buffer exchange to ischemia-mimetic solution and placing of the dishes in hypoxic
pouches (GasPakTM
EZ, BD Biosciences). After 2 h of ischemia, reperfusion was
initiated by a buffer exchange to normoxic KH solution and incubation at 95% room air-
5% CO2. Controls incubated in normoxic KH solution were run in parallel for each
condition. Under control conditions in KH solution cell viability was not compromised.
II-2.8 Fluorescence microscopy
II-2.8.1 Widefield fluorescence microscopy
Cells were observed through a Nikon TE300 fluorescence microscope (Nikon; Tokyo,
Japan) equipped with a 10x lens (0.3 N.A., Nikon), a 40x Plan Fluor and a 60x Plan Apo
objective (1.4 N.A. and 1.3 N.A. oil immersion lenses; Nikon), a Z-motor (ProScanII,
Prior Scientific; Rockland, MA, USA), a cooled CCD camera (Orca-ER, Hamamatsu;
Hamamatsu, Japan) and automated excitation and emission filter wheels controlled by a
LAMBDA 10-2 (Sutter Instrument; Novato, CA, USA) operated by MetaMorph 6.2r4
(Universal Imaging; Buckinghamshire, UK). UV, green, and red fluorescence was
MATERIALS & METHODS
II
37
excited through an excitation filter for DAPI (D350/50x), FITC (HQ480/40x), and Texas
Red (D560/40x), respectively. Fluorescent light was collected via a polychroic
beamsplitter (61002bs) and emission filters for DAPI (D460/50m), FITC (HQ535/50m),
and Texas Red (D630/60m). DAPI, FITC, and Texas Red filters were from Chroma
(Rockingham, VT, USA). In addition, CFP fluorescence was excited through the
excitation filter XF1071, collected via the dichroic beamsplitter XF2034 and the emission
filter XF3075. YFP fluorescence was excited through the excitation filter XF1068,
collected via the dichroic beamsplitter XF2034 and the emission filter XF3074. CFP and
YFP filters were from Omega Optical (Brattleboro, VT, USA).
II-2.8.2 Laser Scanning Confocal Microscopy (LSCM)
LSCM was performed with a Bio-Rad Radiance 2100 laser scanning confocal
microscope (Hercules, CA, USA) using a 60X Plan Apo objective (1.4 N.A oil
immersion lens; Nikon), equipped with both a mixed gas Helium-Neon (543 nm) laser
and an Argon (488 nm) laser, and operated through Bio-Rad LaserSharp 2000 software.
Green and red fluorescence were directed to separate photomultipliers by a 560-nm long-
pass dichroic reflector through HQ530SP and HQ590/70 emission filters, respectively.
The confocal pinholes were configured so as to obtain images of 0.7 µm in the axial
dimension and step increments were 0.3 µm.
II-2.9 Detection of ROS and ∆∆∆∆ΨΨΨΨm
Intracellular ROS levels were assessed using chloromethyl-dichlorodihydrofluorescein
diacetate (CM-DCFH2-DA), which is predominantly retained inside mitochondria due to
covalent binding of the probe’s chloromethyl moiety to the abundant sulfhydryl groups in
the mitochondrial matrix (Presley et al., 2003). ∆Ψm was assessed using
tetramethylrhodamine methyl ester (TMRM) or Rhodamine123 (Rhod123), which
electrophoretically accumulate in the matrix of actively respiring mitochondria and are
released once ∆Ψm is impaired (Bernardi et al., 2001). For dye-loading, CM-DCFH2-DA
(10 µM) was added to the cells prior to sI/R in KH buffer and allowed to load for 30 min
at room temperature to ensure mitochondrial loading of CM-DCFH2-DA. TMRM (5 nM)
was included in the ischemia-mimetic solution or, in normoxic control cells, the KH
solution paralleling the experimental duration of 2 h ischemia simulation. Cells
MATERIALS & METHODS
II
38
expressing either mCherry-Bax or mCherry-BaxT182A
were incubated 30 min with 50 nM
Rhod123 at 37°C in HL-1 medium prior to imaging in dye-free KH solution.
II-2.10 Assessment of mitochondrial morphology
To visualize mitochondria independently of ∆Ψm, cells were transfected with a plasmid
encoding mito-DsRed2 (Clontech) or mito-ECFP (II-2.3.3), in which the fluorescent
proteins DsRed2 or ECFP are fused to the COX IV targeting sequence, thus targeting
them to the mitochondrial inner membrane (Rizzuto, Brini et al. 1995).
II-2.11 Quantification of cellular injury
II-2.11.1 Redistribution of (mCherry-)GFP-Bax
GFP-Bax (Wolter, Hsu et al. 1997) or mCherry-Bax (II-2.3.2) redistribution was used as
a parameter to quantify irreversible cellular injury. Cells were transfected with
(mCherry-)GFP-Bax and allowed to express for 48 hours. Then, cells were subjected to 2
h ischemia in hypoxic pouches followed by 5 h reperfusion and live cells were analyzed
by fluorescence microscopy. Cells were classified as cells with (i) diffuse or (ii) punctate
mitochondrial (mCherry-)GFP-Bax fluorescence. Per condition, a total of approximately
250-500 transfected cells were scored at 60x magnification in three independent
experiments.
II-2.11.2 Plasma membrane integrity
To determine Bnip3-induced cell death, HL-1 cells were co-transfected with (a) pDsRed2
and pcDNA3.1 or Bnip3, in combination with Beclin1 or Beclin1∆Bcl2BD, or (b)
mCherry and pcDNA3.1 or Bnip3, in combination with mCherry-Atg5 or mCherry-
Atg5K130R
, as indicated. 48 h after transfection, cells were stained with 0.1 µM of the
DNA intercalating dye YoPro1 which enters both apoptotic and necrotic cells, but is
excluded from healthy cells (Idziorek et al., 1995). To quantify cell death, cells were
inspected at 20x magnification and pDsRed2- or mCherry-positive cells were evaluated
for YoPro1 staining. Per condition, two replicate dishes were scored in three independent
experiments.
MATERIALS & METHODS
II
39
II-2.12 Quantification of cellular autophagosome content
Cellular contents of autophagosomal structures were quantified via fluorescence imaging
of GFP-LC3 (Mizushima et al., 2004). HL-1 cells were transfected with GFP-LC3 and
48 h after transfection, cells were subjected to sI/R as indicated. Cells were fixed with
4% formaldehyde (Ted Pella; Irvine, CA, USA) in phosphate-buffered saline (PBS, pH
7.4) for 15 min. To quantify the autophagic response among a population of cells, cells
were inspected at 60x magnification and classified as (i) cells with predominantly diffuse
GFP-LC3 fluorescence or as (ii) cells with numerous punctate GFP-LC3 structures,
representing autophagic vacuoles, AVs. A minimum of 150 cells was scored in at least
three independent experiments. For quantification of the autophagic response of single
cells, Z-stacks of GFP-LC3 fluorescence of 7-10 representative cells per condition in
three separate experiments were acquired through the 60x oil immersion lens with 0.3 µm
increments through the entire volume of the cell. Z-stacks were thresholded and total
number and volume of the autophagosome per cell was determined (AutoQuant).
II-2.13 Determination of LC3-II degradation
To analyze autophagic flux, GFP-LC3 expressing cells were subjected to the indicated
experimental conditions with and without a cocktail of the cell-permeable lysosomal
inhibitors bafilomycin A1 (100 nM, vacuolar H+-ATPase inhibitor) to inhibit lysosomal
acidification (required for protease activity (Yoshimori et al., 1991)) and autophagosome-
lysosome fusion (Yamamoto et al.), and E64D (5 µg/mL, inhibitor of cysteine proteases,
including cathepsin B), and pepstatin A methyl ester (5 µg/mL, cathepsin D inhibitor) to
inhibit lysosomal protease activity. Fluorescence microscopy of GFP-LC3 was used to
determine cellular autophagosomal content as described above.
II-2.14 Activity of the lysosomal compartment
LysoTracker Red (LTR) is a cell-permeable acidotropic probe that selectively labels
vacuoles with low internal pH and thus can be used to label functional lysosomes (Bucci,
Thomsen et al.). Following sI/R and control experiments, cells were loaded with 50 nM
LTR for 5 min in KH solution, the medium was then exchanged with dye-free KH
solution, and cells were analyzed by fluorescence microscopy. Activity and intracellular
distribution of cathepsin B, a predominant lysosomal protease, was assessed using (z-
RR)2-MagicRed-Cathepsin B substrate (B-Bridge; Sunnyvale, CA, USA). MagicRed
MATERIALS & METHODS
II
40
cathepsin B substrate (10 nM) was added to the cells during the last 30 min of an
experiment. Cells were rinsed once with PBS prior to analysis by fluorescence
microscopy.
II-2.15 Ca2+ imaging
HL-1 cells were transfected with mito-ECFP and either WT-Bcl-2, mito-Bcl-2, or S/ER-
Bcl-2 at a ratio of 1:4 µg. 48 h after transfection, cells were incubated for 20 min in 2
µM of the Ca2+
-sensitive dye Fluo-4/AM at 37°C in KH solution. Following, the dye-
containing solution was replaced with dye-free KH solution containing 100 µM
norepinephrine, and cells were further incubated for a 30 min at 37°C prior to imaging.
Mito-CFP transfected cells were visually located and 10 consecutive images (1/sec) of
Fluo-4 fluorescence were acquired. 1 µM thapsigargin was then added, let to incubate
for 1 min, and subsequently 10 consecutive images (1/sec) of Fluo-4 fluorescence were
acquired. The average change in Fluo-4 fluorescence (F) intensity (Finitial/(Ffinal-Finitial))
was determined from mean cellular image intensities using the ImageJ multi-ROI
function.
II-2.16 Image processing and analysis
For high-resolution microscopy, Z-stacks of representative cells were acquired at 40x or
60x magnification with 0.3 µm increments capturing total cellular volume. Aquired
widefield Z-stacks were routinely deconvolved using 10 iterations of a 3D blind
deconvolution algorithm (AutoQuant, Media Cybernetics; Silver Spring, MD, USA) to
maximize spatial resolution. Representative cells are shown as maximum projections of
3D-deconvolved Z-stacks, unless stated otherwise.
Image analysis and figure preparation was performed using the National Institutes
of Health public domain software ImageJ (http://rsb.info.nih.gov/ij). When required for
optimal visualization, multi-color look-up-tables (LUT) were applied to grey-scale
images. 3D images were reconstructed from Z-stacks using the volume rendering plugin
for ImageJ (VolumeJ; (Abramoff and Viergever, 2002);
http://www.isi.uu.nl/people/michael/vr.htm).
MATERIALS & METHODS
II
41
II-2.17 Immunoblotting
Cells were harvested by scraping and centrifugation at 550 g for 5 min at 4°C and washed
once with cold PBS (pH 7.4). To prepare whole cell lysates, cell pellets were redissolved
in cold RIPA buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Triton-X 100, 0.1%
SDS, 1 mM EDTA, 1 mM Na3VO4, 1 mM NaF, and protease inhibitor cocktail (Roche))
and left on ice for 15 min. The cell extracts were centrifuged at 20 000 g for 5 min to
remove cellular debris. Protein concentrations were determined using Coomassie Plus
Reagent (Pierce) and samples were diluted for equal loading per well. After addition of
sample buffer and reducing agent (Bio-Rad) samples were incubated at 95°C for 5 min
and electrophoresed on 10% Bis-Tris SDS-PAGE gels (Bio-Rad) and transferred to
nitrocellulose membranes (Bio-Rad) according to standard methods (Laemmli, 1970).
Following, membranes were stained with Ponceau S (Pierce) to verify uniform loading
and transfer. For immunodetection the membranes were blocked in 5% dry milk in
TBST (Tris-buffered saline (TBS)-Tween; 100 mM NaCl, 10 mM Tris, 0.05% Tween,
pH 7.4) and then incubated with the primary antibody (II-1.1.1) in TBST/5% dry milk for
2 h at room temperature (or overnight at 4°C). After three washing steps with TBST for
10 min the blot was incubated with the horseradish peroxidase-conjugated secondary
antibody (II-1.1.2) in TBST/5% dry milk for 1 h at room temperature. Subsequently, the
membrane was washed three times with TBST and antibody-labeled proteins were
detected using SuperSignal West Pico chemiluminscence substrate (Pierce). Apparent
molecular weights were estimated from the migration rates of Precision Plus Protein
Standards (Bio-Rad). Blots shown are representative of at least three independent
experiments.
II-2.18 Statistics
The probability of significant differences between experimental groups was determined
by the Student’s t-test. Values are expressed as mean±S.E.M. of at least three
independent experiments unless stated otherwise.
Chapter 3
Proapoptotic Bcl-2 Family Members and Mitochondrial
Dysfunction during Ischemia/Reperfusion Injury in HL-1
Cardiac Myocytes
________________________________________________________________________
Adapted from: Brady N.R.1, Hamacher-Brady A.
1, and R.A. Gottlieb (2006). “Proapoptotic Bcl-2
family members and mitochondrial dysfunction during ischemia/reperfusion injury: a study
employing cardiac HL-1 cells and GFP-biosensors.” BBA - Bioenergetics, in press. 1Authors
contributed equally.
RESULTS: sI/R in HL-1 cells
III
45
The dynamics of Bax and Bid activation, in relation to mitochondrial dysfunction are
unclear in the context of I/R injury in the heart. The objective in this study was to
evaluate alterations to mitochondrial function in a cell-based model of myocardial
ischemia/reperfusion (I/R) injury. Using reporter dyes, GFP-biosensors and fluorescence
deconvolution microscopy we investigated mitochondrial function and morphology in
relation to Bax and Bid activation in the HL-1 cardiac cell line.
III-1 Simulated I/R in HL-1 cardiac myocytes induces mitochondrial
dysfunction and PCD
To simulate ischemia, which is characterized by a reduction in the supply of oxygen and
nutrients, resulting in lactate accumulation and intracellular acidosis, cells were bathed in
a hypoxic, glucose-free, lactate-containing acidic KH solution (pH 6.6) containing 2-
deoxyglucose to inhibit glycolysis (Maddaford et al., 1999). Following an ischemic
period of 2 h, reperfusion was initiated by exchanging the ischemic solution with
normoxic KH solution. Under control conditions, where cells were maintained in
normoxic KH solution for the duration of the experiment, cell viability was not
compromised. In response to sI/R, however, HL-1 cells reproducibly underwent cell
death over a time-course of several hours, as determined by plasma membrane
permeability to YoPro1 and propidium iodide (Bond et al., 1991; Idziorek et al., 1995)
(data not shown).
Mitochondrial dysfunction, characterized by the generation of ROS and loss of
∆Ψm, is a critical feature of I/R injury (Gottlieb, 2003; Levraut et al., 2003). Preservation
of mitochondrial integrity is essential for energy homeostasis and survival of the cardiac
myocyte, while compromised mitochondrial integrity ultimately leads to the conversion
of mitochondria into executers of PCD. We investigated whether our model of sI/R
activated classic parameters of mitochondrial dysfunction. 90 min after reperfusion, HL-
1 cells displayed decreased ∆Ψm, as indicated by decreased TMRM fluorescence, as well
as enhanced mitochondrial ROS generation, as indicated by increased mitochondrial-
concentrated CM-DCF fluorescence (Fig. 6). Notably, sI/R-activated ROS production
and ∆Ψm collapse occurred heterogeneously within the population of HL-1 cells. The
HL-1 cell line responds to 2 h simulated ischemia and 90 min reperfusion rather than the
RESULTS: sI/R in HL-1 cells
III
46
many hours of simulated ischemia required for neonatal myocytes or H9c2 cells. In this
respect, it more closely resembles adult cardiomyocytes which initiate similar responses
after 30 min simulated ischemia and 90 min reperfusion. The production of ROS and
mitochondrial depolarization also recapitulate well characterized events in myocardial
I/R injury.
TMRM (∆Ψ)
Control 90’ Reperfusion
CM-DCF (ROS)
Control 90’ Reperfusion
TMRM (∆Ψ)
Control 90’ Reperfusion
CM-DCF (ROS)
Control 90’ Reperfusion
FIG. 6. sI/R in HL-1 cardiac myocytes leads to mitochondrial dysfunction. HL-1 cells were
loaded with 10 µM CM-DCFH2-DA and subjected to 2 h ischemia in the presence of 5 nM TMRM. Following, reperfusion was introduced by a buffer exchange to dye-free KH solution. At 90 min of reperfusion, TMRM (upper panels) and CM-DCF (lower panels) fluorescence were compared to
normoxic control cells, which had been identically treated with dyes, to assess ∆Ψm and ROS levels, respectively. Representative images were acquired at 20x magnification under the exact same conditions to ensure comparability. Multicolor look up tables (LUT) were applied to grey scale images to visualize the range of fluorescence intensities with black representing lowest
pixel values and white representing highest pixel values. Scale bars, 50 µm.
III-2 Mitochondrial dysfunction and fragmentation
The modulation of mitochondrial morphology is an important parameter of mitochondrial
function. Recent studies have shown that during PCD induced by staurosporine
RESULTS: sI/R in HL-1 cells
III
47
(Karbowski et al., 2002), metabolic inhibition (Lyamzaev et al., 2004), or hydrogen
peroxide (Skulachev et al., 2004), fragmentation of the mitochondrial network is a
consistent feature.
Using mitochondrial-targeted fluorescent markers for mitochondria, either mito-
DsRed2 or mito-ECFP, we assessed mitochondrial morphology during sI/R-induced
injury using high resolution imaging. Prior to the ischemic insult, mito-DsRed2-labeled
mitochondria were observed as elongated, branched organelles, whereas mitochondrial
fragmentation occurred during ischemia and persisted during reperfusion (Fig. 7). Cells
incubated under control conditions (in KH solution) remained filamentous for more than
24 h (data not shown). These results indicate that a process of dramatic mitochondrial
remodeling is initiated during simulated ischemia.
Mito-DsRed2
Before sI/R
20’ ischemia
60’ reperfusion
FIG. 7. sI/R causes the disruption of the mitochondrial network. HL-1 cells were subjected to sI/R in the Leiden perfusion chamber mounted to the stage of the fluorescence microscope and mitochondrial dynamics were monitored by 4D-imaging of mito-DsRed2 with 20 min intervals between frames. During normoxic conditions prior to ischemia, mitochondria were branched and elongated (upper panel). sI/R induced fragmentation of the mitochondrial network (lower panels).
RESULTS: sI/R in HL-1 cells
III
48
III-2.1 sI/R-induced mitochondrial fragmentation is mediated by Drp1
To determine if mitochondrial fragmentation occurring during sI/R was due to specific
activity of known protein mediators of mitochondrial fission, and not an unspecific event,
cells were transiently transfected with vectors encoding either Drp1, which promotes
mitochondrial fission, or a GTPase-dead dominant negative of Drp1 (Drp1K38E
) which
blocks mitochondrial fission (Smirnova et al., 1998). Mitochondrial morphology was
examined using mito-DsRed2 as a mitochondrial marker (Fig. 8). Under control
conditions Drp1 increased the number of cells exhibiting the fragmented phenotype.
Drp1K38E
, as previously described, inhibited fragmentation, resulting in supra-networks
and perinuclear clustering (Smirnova et al., 1998).
Following ischemia, mitochondria of control and Drp1 overexpressing cells
underwent pronounced fragmentation. Fragmentation was significantly reduced by
expression of Drp1K38E
. Notably, fragmented mitochondria in Drp1 overexpressing cells
remained distributed throughout the cell, as opposed to control cells where mitochondrial
fragments clustered in perinuclear regions. Perinuclear clustering of mitochondria has
been described previously in PCD and attributed to activity of the mitochondrial fission
machinery, or impaired kinesin-dependent transport of mitochondria (Li et al., 1998;
Frieden et al., 2004).
III-3 Bax activation in sI/R One key feature of sI/R-induced cell death is the participation of the pro-apoptotic Bcl-2
protein Bax in the mitochondrial death pathway (Wolter et al., 1997). Under normal
conditions Bax is found homogeneously distributed throughout the cell. In neonatal
cardiac myocytes, Bax translocates to the mitochondria in response to staurosporine and
prolonged chemical hypoxia (Capano and Crompton, 2002).
RESULTS: sI/R in HL-1 cells
III
49
B
Representative images
Vector Drp1 Drp1K38R
KH
sI/R
(at
30
‘repf.
)
A
K38E
*
**
0
20
40
60
80
100
Vector Drp1 Drp1
% c
ells
with f
rag
mente
d
mitochondria
KH sI/R
FIG. 8. Drp1 mediates the disruption of the mitochondrial network. HL-1 cells were transfected with mito-DsRed2 to visualize mitochondrial morphology and incubated in KH solution or subjected to sI/R. At 30 min reperfusion, mitochondrial morphology was examined in live cells using a 60x lens. (A) Shown are maximum projections of representative images. During normoxic conditions prior to ischemia, mitochondria were branched and elongated. sI/R induced fragmentation of the mitochondrial network. Drp1 overexpression resulted in increased fragmentation of the mitochondrial network under control conditions (KH solution). Drp1
K38E
expression reduced sI/R activated mitochondrial fission. (B) Quantification of changes to mitochondrial morphology, as a function of Drp1, Drp1
K38E expression and sI/R (*p<0.001;
**p<0.05).
RESULTS: sI/R in HL-1 cells
III
50
III-3.1 Bax translocation and clustering
Using constructs encoding human Baxα fused to either EGFP (GFP-Bax (Wolter et al.,
1997) or monomeric red fluorescing mCherry (Shaner et al., 2004), (mCherry-Bax), we
investigated Bax translocation and clustering on mitochondria in response to sI/R. Under
normal conditions GFP-Bax was homogeneously distributed throughout the cytosol (Fig.
9). During the 2 h ischemic treatment, GFP-Bax detectably translocated in only a few
cells (~15%, data not shown). The majority of GFP-Bax translocation to the
mitochondria occurred during reperfusion. GFP-Bax initially circumscribed the outer
mitochondrial membrane and then, several hours into reperfusion, formed the typical
punctate GFP-Bax foci , or clusters (Nechushtan et al., 2001; Lim et al., 2002), at or on
fragmented mitochondria (Fig. 9).
sI/
RC
ontr
ol
Mito-DsRed2 GFP-Bax merge
FIG. 9. sI/R-induced Bax translocation to mitochondria. HL-1 cells were transfected with mito-DsRed2 to visualize mitochondria and GFP to follow changes in subcellular localization of Bax during sI/R. In normoxic control cells GFP-Bax exhibits diffuse cytosolic and nuclear fluorescence distributed equally throughout the cell (upper panels). Starting in ischemia and extending into the reperfusion period, Bax translocates to the mitochondria, where it coats them homogeneously (data not shown). By the time cells have completed 2 h ischemia and 5 h reperfusion, GFP-Bax is found as clusters surrounding individual swollen mitochondria (lower
panels). Scale bars, 10 µm. Identical results were obtained with mCherry-Bax.
RESULTS: sI/R in HL-1 cells
III
51
III-3.2 Bax translocation and clustering, mitochondrial fragmentation, and ∆∆∆∆ΨΨΨΨm
To further explore the two phases of Bax activation (translocation and clustering) we
transiently expressed a C-terminal threonine-to-alanine point mutant of Bax (T182A)
fused to mCherry (mCherry-BaxT182A
). BaxT182A
has been recently shown to
spontaneously translocate to mitochondria and in some cell types can trigger apoptosis
(Precht et al., 2005). The translocation of Bax to mitochondria is a prerequisite for
mitochondrial outer membrane permeabilization for cytochrome c release as well as for
the MPTP (Shimizu et al., 1999; Saito et al., 2000)
In HL-1 cells, the majority of mCherry-BaxT182A
was associated with the mitochondria
even under basal conditions (Fig. 10A). Interestingly, in the absence of sI/R, cells
transfected with either mCherry-Bax or mCherry-BaxT182A
exhibited polarized,
filamentous mitochondria, indicating intact mitochondrial function (Fig. 10B).
Moreover, for up to 4 days following transfection, BaxT182A
was not sufficient to induce
apoptosis in HL-1 cells. We therefore asked whether the mitochondrial localization of
Bax sensitized cells to sI/R injury. Bax-mCherry clustering was quantified at time points
2.5 h and 5 h of reperfusion. At 2.5 h of reperfusion, there was no statistically significant
difference between mCherry-Bax and mCherry-BaxT182A
clustering. However, at 5 h of
reperfusion, mCherry-BaxT182A
clustering was significantly higher than for mCherry-Bax
(Fig. 10C). These results indicate that in HL-1 cells Bax translocation itself is not
sufficient to induce mitochondrial fragmentation or depolarization, but that it may
sensitize the mitochondria to injury or shorten the interval to complete apoptosis. Thus,
Bax translocation may be regarded as a priming event. Bax clustering on the other hand
can be considered as an index of irreversible injury as it was followed by plasma
membrane permeabilization as determined by YoPro1 labeling (results not shown).
MAPK (mitogen-activated protein kinase) p38 is an established participant in I/R
activated PCD in the heart (Baines et al., 2005) Moreover, treatment with p38 inhibitors
can block nitric oxide-induced Bax activation (Ghatan et al., 2000). To determine the
effect of p38 on Bax translocation and clustering in our model of sI/R, we added the p38
inhibitor SB203580 at reperfusion. Inhibition of p38 significantly blunted mCherry-Bax
translocation and clustering. To determine if p38 was required just for translocation or if
it was also required for clustering, we evaluated the effect of SB203580 on mCherry-
RESULTS: sI/R in HL-1 cells
III
52
BaxT182A
(Fig. 10C). As previously observed, mCherry-BaxT182A
spontaneously
associated with mitochondria; however, the addition of SB203580 at reperfusion
prevented clustering. Taken together, these results indicate a role for p38 in both steps in
Bax activation.
In addition, we noted that while >90% of mitochondria were fragmented at the
end of ischemia, a morphology that persisted beyond 5 h reperfusion, cells treated with
SB203580 exhibited filamentous mitochondria at 5 h reperfusion, indicating that the
filamentous mitochondrial network had re-formed (Fig. 10D). This suggests that p38
may play an active role in regulating mitochondrial structure during I/R injury.
FIG. 10. Bax translocation to mitochondria independent of mitochondrial dysfunction. (A) Cells were co-transfected with mCherry-Bax constructs and mito-ECFP and cells were imaged in KH solution. Whereas mCherry-Bax(wt) was found to be homogeneously distributed throughout
the cell, mCherry-BaxT182A
was found to coat the mitochondrial networks of the cell. (B) ∆Ψm was determined using Rhodamine 123 (Rhod123, 50 nM). Cells expressing mCherry-Bax(wt) or mCherry-Bax
T182A exhibited similar levels of filamentous, polarized mitochondria. (C) Bax
mitochondrial localization and effect of p38 inhibition on Bax activation. At 2.5 h reperfusion the extent of clustering of mCherry-Bax
T182A was similar to mCherry-Bax(wt). At 5 h reperfusion
mCherry-BaxT138A
formed significantly more clusters than mCherry-Bax(wt) (p<0.01). SB203580
(10 µM) significantly decreased the percentage of cells with Bax clustering in both mCherry-Bax and mCherry-Bax
T182A expressing cells (p<0.01). (D) SB203580 effect on mitochondrial
morphology. At 5 h reperfusion, decreased mCherry-Bax(wt) and or mCherry-BaxT182A
clustering correlated with recovery of mitochondrial networks as revealed by imaging of mito-ECFP. mCherry-Bax(wt) was homogeneously distributed following SB203580 treatment at reperfusion.
*
***
RESULTS: sI/R in HL-1 cells
III
53
Mitochondrial depolarization occurred following fragmentation but prior to Bax
clustering. Mitochondrial depolarization is often a result of MPTP opening. To assess
whether Bax clustering caused or was a result of MPTP opening, we treated HL-1 cells
with CsA (1 µM). This intervention significantly reduced sI/R-induced GFP-Bax
clustering (Fig. 11), indicating that MPTP opening was upstream of Bax clustering.
0
10
20
30
40
50
60
70
Control CsA
% c
ells
with
pu
ncta
te G
FP
-Ba
x
KH sI/R
*
FIG. 11. MPTP is upstream of GFP-Bax activation. GFP-Bax expressing cells were subjected
to sI/R with or without 1 µM CsA. At 5 h of reperfusion, cells were classified as displaying diffuse cytosolic or punctate mitochondrial GFP-Bax localization. The percentage of cells with punctate
GFP-Bax distribution per total cells scored is represented as the mean±S.E.M. of three independent experiments, each performed in duplicate. CsA significantly reduced redistribution and clustering of GFP-Bax at the mitochondria (*p<0.05).
III-4 GFP-Bax clustering as a parameter of sI/R-induced injury
Using mitochondrial clustering of GFP-Bax as an index to monitor activation of PCD
(Fig. 12A) we found that sI/R induced PCD in a hypoxia/reoxygenation-dependent
manner (Fig. 12B).
RESULTS: sI/R in HL-1 cells
III
54
0
10
20
30
40
50
60
70
80
90
100
KH sI/R
Normox
sI/R
% c
ells
with
puncta
te G
FP
-Bax
A BNormoxic
sI/R (5h reperfusion)
*
FIG. 12. sI/R-specific GFP-Bax clustering. GFP-Bax transfected HL-1 cells were incubated in either KH solution or ischemia-mimetic solution for 2 h in normoxic (sI/R Normox) or hypoxic (sI/R) conditions followed by 5 h reperfusion in normoxic KH solution. (A) Z-stacks of
representative cells were acquired at 60x magnification with 0.3 µm increments. Shown are the maximum projections of total cellular GFP-Bax fluorescence. (B) Cells were then classified as displaying diffuse cytosolic or punctate mitochondrial GFP-Bax localization. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (*p<0.05).
Overexpression of both Bcl-2 and Bcl-xL, known protectors against cardiac I/R injury
(Brocheriou et al., 2000; Imahashi et al., 2004; Huang et al., 2005), significantly reduced
sI/R-induced GFP-Bax clustering, further demonstrating suitability of the experimental
model (Fig. 13A, B). Interestingly, both wild-type (WT-)Bcl-2 and mitochondrial-
targeted (mito-)Bcl-2 significantly protected against sI/R-induced GFP-Bax clustering,
while S/ER-targeted (S/ER-)Bcl-2 did not significantly affect GFP-Bax clustering (Fig.
13C).
RESULTS: sI/R in HL-1 cells
III
55
0
5
10
15
20
25
Vector WT-Bcl2 Mito-Bcl2 S/ER-Bcl2
% c
ells
with
pu
ncta
te G
FP
-Ba
x
KH sI/R
* **
0
10
20
30
40
50
60
70
Vector Bcl-2 Bcl-xL
% c
ells
with
pun
cta
te G
FP
-Ba
x
KH sI/RA B
* *
Actin
Bcl-x
L
Co
ntr
ol
Bcl-xL
Bcl-2
Co
ntr
ol
Actin
Bcl-2
C
Fig. 13. Anti-apoptotic Bcl-2 and Bcl-xL oppose sI/R-induced GFP-Bax clustering. (A) GFP-Bax transfected cells were co-transfected with Bcl-2 or Bcl-xL and overexpression of Bcl-2/-xL was verified by immunodetection of cell lysates. (B) GFP-Bax clustering was assessed under both control and sI/R conditions as under B (*p<0.05). (C) GFP-Bax clustering was assessed in control cells and cells co-expressing WT-Bcl-2, mito-Bcl-2, and S/ER-Bcl-2 (*p<0.01; **p<0.05).
RESULTS: sI/R in HL-1 cells
III
56
BBcl-xL
KH
sI/R
C
A
*
K38E
0
20
40
60
80
Vector Drp1 Drp1% c
ells
with p
uncta
teG
FP
-Bax
KH sI/R
0
20
40
60
80
100
Vector Bcl-xL
% c
ells
with
fra
gm
en
ted
m
ito
cho
nd
ria
KH sI/R
FIG. 14. Fissioned mitochondria afford protection from sI/R injury in HL-1 cells and Bcl-xL protects independently of mitochondrial fission. (A) HL-1 cells were co-transfected with GFP-Bax and either empty vector (control), Drp1, or Drp1
K38E. At 5 h following sI/R, GFP-Bax
activity (defined as punctate mitochondrial GFP-Bax localization) was quantified (*p<0.05). (B) Cells were co-transfected with mito-DsRed2 and Bcl-xL and subjected to sI/R. Shown are the maximum projections of representative cells under control (normoxic KH) or sI/R (at 30 min reperfusion) conditions. (C) Cells were co-transfected with GFP-Bax and empty vector or Bcl-xL and GFP-Bax clustering was quantified as described above.
RESULTS: sI/R in HL-1 cells
III
57
III-5 Drp1-mediated mitochondrial fragmentation protects against sI/R
We next determined the significance of mitochondrial morphological states (fragmented
vs. fused) in mediating the injury response to simulated I/R as determined via GFP-Bax
clustering. Drp1 significantly reduced sI/R-activated GFP-Bax clustering (Fig. 14A).
Drp1K38E
had no significant effect on GFP-Bax activity in response to sI/R. These results
indicate that ischemia-induced mitochondrial fission mediated by Drp-1 affords
protection from sI/R injury.
In order to understand the above results in the context of PCD, we then
overexpressed the anti-apoptotic protein Bcl-xL and examined the effect on mitochondrial
fragmentation. Bcl-xL, although protecting against GFP-Bax clustering (Fig. 13B), did
not block mitochondrial fragmentation (Fig. 14B, C), indicating that Bcl-xL does not
achieve mitochondrial protection through effects on mitochondrial fragmentation. We
infer that fragmentation precedes and is independent of mitochondrial pro-apoptotic
alterations.
III-6 Bid activation in sI/R monitored by a GFP biosensor
Bid is another pro-apoptotic Bcl-2 protein whose activation is thought to be a causative
event during myocardial I/R injury (Chen et al., 2002). To explore the kinetics of sI/R-
induced Bid activation in a time and spatially resolved manner, we constructed a GFP-
based biosensor, in which full-length Bid is flanked by YFP at the N-terminus and CFP at
the C-terminus (YFP-Bid-CFP). This was chosen in order to enable tracking of both the
N- and C-terminal fragments of Bid.
Under control conditions, both YFP and CFP fluorescence were distributed
homogeneously throughout the cell (Fig. 14A) consistent with the cytosolic distribution
of Bid in healthy cells. In cells which had been subjected to simulated ischemia followed
by prolonged hours of reperfusion (+6 h), however, YFP-Bid displayed mainly a diffuse
cytosolic staining pattern while C-terminal Bid-CFP (containing the BH3 domain) was
found at distinct subcellular regions (Fig. 15A). Dual imaging of mito-DsRed2 and tBid-
CFP identified mitochondria as the subcellular targets of Bid (Fig. 15B).
RESULTS: sI/R in HL-1 cells
III
58
A
B sI/R
Bid-CFP Mito-DsRed Merge
sI/R
Bid-CFP YFP-Bid Merge
Control
Bid-CFP YFP-Bid Merge
sI/R
Bid-CFP YFP-Bid Merge
Control
Bid-CFP YFP-Bid Merge
FIG. 15. YFP-Bid-CFP sensor to monitor Bid activation. (A) Cells were transfected with YFP-Bid-CFP and analyzed by 3D fluorescence imaging under control conditions and after 2 h ischemia and 6 h reperfusion. Under control conditions both CFP and YFP signals of Bid exhibit diffuse fluorescence. Following 6 h of reperfusion, Bid-CFP (C-terminal fragment) exhibits a punctate distribution resembling mitochondria, while YFP-Bid (N-terminal fragment) is diffusely distributed. (B) After sI/R, Bid-CFP co-localizes with mito-DsRed2 visually confirming the mitochondrial localization of activated tBid-CFP.
III-6.1 sI/R-induced cardiac myocyte Bid cleavage is mediated by caspase 8
Bid can be cleaved by various proteases such as caspase 8 (Li et al., 1998), calpain (Chen
et al., 2001; Mandic et al., 2002) cathepsin proteases (Stoka et al., 2001), and granzyme
B (Heibein et al., 2000; Sutton et al., 2000). While calpain has been reported to play a
role in I/R-induced Bid cleavage in the perfused whole heart model (Chen et al., 2001),
RESULTS: sI/R in HL-1 cells
III
59
Bid cleavage has been attributed to varying proteases depending on the death stimulus
and cell type (e.g., caspase 8 in cardiomyocytes vs. caspase 9 in endothelial cells in
response to sI/R the isolated heart (Scarabelli et al., 2002).
To determine whether caspase 8 was the responsible protease in sI/R-induced Bid
cleavage in HL-1 cells, we inserted a point mutation within the caspase 8 cleavage site of
Bid, generating Bid∆casp8, and subcloned it into the Bid biosensor. TNF-α activates
PCD involving caspase 8 dependent cleavage of Bid (Li et al., 1998). Treatment of HL-1
cells transfected with either Bid-sensor or Bid∆casp8-sensor with TNF-α resulted in the
cleavage of Bid-sensor but not Bid∆casp8-sensor, indicating successful mutation of the
caspase 8 cleavage site (Fig. 16A). Cells expressing the Bid∆casp8-sensor were
subjected to 2 h ischemia and 6 h reperfusion. The Bid∆casp8 cleavage product was not
detected although the cleavage product could be detected in cells expressing the wild type
Bid-sensor (Fig. 16A). Likewise, inhibition of caspases with 50 µM zVAD-fmk inhibited
sI/R-induced cleavage of ectopically expressed Bid-sensor as well as endogenous Bid,
while the presence of 10 µM ALLN, an inhibitor of calpain and cathepsins B and L, did
not affect Bid cleavage (Fig. 16B). These results indicate that caspase 8 is responsible for
Bid cleavage after sI/R of HL-1 cardiac myocytes.
Contr
ol
TN
F-α
Contr
ol
TN
F-α
sI/R
WT M WT M
sI/R
YFP-Bid-CFP
tBid-CFP
A sI/R
sI/R
+ A
LL
N
sI/R
+ z
VA
D-f
mk
tBid-CFP
Actin
FL-Bid
B
FIG. 16. Bid cleavage during sI/R is mediated by caspase 8. (A) HL-1 cells were transfected
with either Bid-sensor (WT) or Bid∆casp8-sensor (M) and treated with TNF-α (100 ng/ml) for 24 h. Proteins of whole cell lysates were separated by SDS-PAGE, transferred to nitrocellulose, and probed with anti-FP antibody to detect WT and M Bid-sensor (78 kDa) and cleavage product tBid-CFP (42 kDa). (B) Bid-sensor expressing cells were subjected to 2 h ischemia followed by 6 h
reperfusion in the presence of the protease inhibitors ALLN (10 µM) or zVAD-fmk (50 µM). Western blots of whole cell lysates were probed with anti-FP, anti-Bid, and anti-actin antibodies.
RESULTS: sI/R in HL-1 cells
III
60
A
B tBid-CFPmCherry-Bax
rendering
Control Control
mCherry-Bax Bid-CFP Merge
mCherry-Bax Bid-CFP Merge
sI/R
FIG. 17. Sequential activation of Bax and Bid in response to sI/R. (A) HL-1 cells were co-transfected with mCherry-Bax and YFP-Bid-CFP. CFP and mCherry signals were detected under control conditions (2+5 h KH solution) and after 2 h simulated ischemia and 5 h reperfusion. (B) To determine whether tBid and Bax colocalize at mitochondria, HL-1 cells transfected with Bid-sensor and mCherry-Bax were subjected to 2 h ischemia followed by 6 h reperfusion and analyzed by fluorescence microscopy. Z-stack was 3D-rendered using the VolumeJ plugin for ImageJ. 3D rendering reveals the distinct pattern of distribution of mCherry-Bax (clusters) and tBid-CFP (homogeneous mitochondrial pattern).
RESULTS: sI/R in HL-1 cells
III
61
III-7 Spatio-temporally resolved interplay of Bid and Bax at the
mitochondria
During the preceding experiments, we noted that Bid truncation and translocation to the
mitochondria occurred at a later time point than mitochondrial Bax translocation and
clustering. In order to resolve the spatio-temporal interplay of Bid and Bax at the
mitochondria, we transfected cells with both mCherry-Bax and YFP-Bid-CFP. Under
control conditions both mCherry-Bax and YFP-Bid-CFP were distributed homogeneously
throughout the cell. However, after 2 h ischemia and 5 h of reperfusion, mCherry-Bax
was detected at the mitochondria, mainly in the absence of YFP-Bid-CFP redistribution,
which could be detected more frequently at later times (Fig. 17A). These results are
consistent with the notion that Bax translocation and activation at the mitochondria
occurs prior to massive Bid activation. Although tBid is thought to function in concert
with Bax (Lim et al., 2002), we found that Bid did not localize to the Bax clusters but
instead displayed a homogeneous mitochondrial distribution (Fig. 17B).
Chapter 4
Bcl-2 Regulation of Sarco-/Endoplasmic Reticulum
Calcium Stores Mediates the Autophagic Response to
Nutrient Deprivation in HL-1 Cardiac Myocytes
________________________________________________________________________
Adapted from: Brady N.R., Hamacher-Brady A., and R.A. Gottlieb. “Bcl-2 regulation of
sarco/endoplasmic reticulum calcium stores mediates the autophagic response to nutrient
deprivation in the HL-1 cardiac myocyte.” Submitted.
RESULTS: Quantifying autophagic activity
IV
65
Recent findings evidence a link between the apoptotic and autophagic pathways through
the interaction of the anti-apoptotic proteins Bcl-2 and Bcl-xL with Beclin1 (Liang et al.,
1998; Saeki et al., 2000; Shimizu et al., 2004; Pattingre et al., 2005). However, the
nature of the interaction, either in promoting or blocking autophagy remains
controversial. In part this is due to incorrect use of tools available for detecting the
autophagic response: currently, a demonstration of increased presence of either
autophagic vacuoles (AVs) or protein markers thereof, is the standard means for
detecting changes in autophagic activity.
However, autophagy involves the delivery of the autophagosomes and their
contents to lysosomes which contain the degradative enzymes needed to complete the
catabolic processes of autophagy (Klionsky and Emr, 2000). Therefore, an increased
presence of AVs may either reflect (i) enhanced formation of AVs, (ii) impaired fusion of
AVs with lysosomes to generate autophagolysosomes, or (iii) a combination of both.
Moreover, the AVs may be removed by lysosomal degradation at a rate that exceeds our
imaging capabilities; i.e., the transit is so rapid and/or the AVs so small that only a few
AVs can be detected at any given time. Accordingly, a low number of AVs may be due
to either low or high autophagic activity.
Here we implement a highly-sensitive, macroautophagy-specific assay which
allows for the distinction between enhanced AV production and suppressed AV
degradation. Using this assay we investigated the control of Beclin1 and Bcl-2 on
nutrient deprivation-activated autophagy.
IV-1 Inhibiting lysosomal activity to quantify autophagic flux
During the initiation of autophagy, cytosolic LC3 (LC3-I) is cleaved and lipidated to
form LC3-II (Kabeya et al., 2004; Tanida et al., 2005). LC3-II is then recruited to the
autophagosomal membrane (Mizushima et al., 2001). Thus, punctate GFP-LC3-labeled
structures represent AVs. Importantly, overexpression of (GFP-)LC3 does not affect
autophagic activity, and transgenic mice expressing GFP-LC3 display no detectable
abnormalities (Kirisako et al., 1999; Mizushima et al., 2004).
In this study we utilized the extent of GFP-LC3-labeled AV formation during a
set amount of time as a specific index of macroautophagic activity. Lysosomal
RESULTS: Quantifying autophagic activity
IV
66
degradation of AVs was blocked using a cocktail consisting of the cell-permeable
pepstatin A methyl ester (5 µg/µl, inhibitor of cathepsin D), (2S,3S)-trans-epoxysuccinyl-
L-leucylamido-3-methylbutane ethyl ester (E64d; 5 µg/µl, inhibitor of cathepsin B) and
bafilomycin A1 (Baf A1, 50 µM; inhibitor of v-ATPase). To verify the inhibition of
cathepsin activity we utilized the fluorescent MagicRed Cathepsin B substrate
(Lamparska-Przybysz et al., 2005). Under normal conditions MagicRed fluorescence is
localized to individual organelles representing the lysosomes due to processing of the
substrate to its fluorescent form by the lysosomal protease cathepsin B (Fig. 18A). In
cells treated with the inhibitor cocktail, fluorescence intensity was decreased due to
decreased MagicRed processing by cathepsin B. Similarly, lysosomal acidification
which is required for protease activity (Yoshimori et al., 1991) and AV-lysosome fusion
(Yamamoto et al., 1998), was inhibited as assayed by LysoTracker Red (Fig. 18B).
Ma
gic
Red
LT
R
KH KH + i
KH KH + Baf A1
A
B
FIG. 18. Inhibition of lysosomal activity with the inhibitor cocktail. (A) Inhibition of cathepsin B activity by lysosomal inhibitors. Activity and intracellular distribution of cathepsin B, a predominant lysosomal protease, was assessed using MagicRed-Cathepsin B substrate. HL-1 cells were treated with lysosomal inhibitors (Baf A1, pepstatin A methyl ester, and e64D) for 2 h with MagicRed present during the last 30 min of the experiment. (B) Inhibition of v-ATPase activity by Baf A1. Following 2 h incubation in KH + Baf A1, cells were loaded with 50 nM LysoTracker Red (LTR) for 5 min. The solution was then exchanged with dye-free KH solution, and cells were analyzed by fluorescence microscopy. (A+B) Shown are the maximum projections of deconvolved Z-stacks of representative cells acquired at 40x magnification.
RESULTS: Quantifying autophagic activity
IV
67
IV-2 Quantifying autophagy in HL-1 cardiac myocytes
We first characterized the basal level of autophagy in fully supplemented medium
(Claycomb et al., 1998). GFP-LC3 expressing HL-1 cells were treated with the
lysosomal inhibitor cocktail for a period of 3.5 h and the percentage of cells
demonstrating a robust intracellular accumulation of GFP-LC3-labeled AVs (active
autophagy) was determined by fluorescence imaging. Two populations were readily
apparent: under full medium conditions in the absence of the inhibitor cocktail the
majority of the cells contained few or no AVs (Fig. 19A). In the presence of lysosomal
inhibitors, only a small, statistically insignificant increase in the percentage of cells
exhibiting high AV content was observed, evidencing low autophagic activity under high
nutrient conditions. The results, represented as bar graphs, thus indicate the percentage of
cells showing numerous AVs at steady-state (absence of inhibitors; representing either
increased AV formation or slow degradation) and under inhibited degradation of AVs
(cumulative AV formation over a fixed period of time). The difference in cells with high
AV content in the presence or absence of inhibitors (number in graphs) represents the
percentage of cells with high autophagic flux (Fig. 19B).
IV-2.1 Pharmacologic activation of autophagy
We next sought to gauge the accuracy of our method to determine autophagic flux by
evaluating the effect of agents known to perturb the autophagic pathway. Rapamycin can
stimulate autophagy even under high nutrient conditions (Noda and Ohsumi, 1998).
GFP-LC3-expressing HL-1 cells were treated with the lysosomal inhibitor cocktail in full
medium, without and with rapamycin. In the absence of lysosomal inhibitors, the
percentage of cells with high AV content increased only slightly in response to
rapamycin (Fig. 19A). Lysosomal inhibition in rapamycin-treated cells, however,
resulted in a profound further increase in the percentage of cells with high AV content,
revealing the autophagy-inducing potential of rapamycin (Fig. 19B). Furthermore, our
results demonstrate that the rapamycin-induced AV formation in full medium exceeds the
capacity for AV degradation, as steady-state levels of AVs increased even though flux
greatly increased.
RESULTS: Quantifying autophagic activity
IV
68
A FM FM + RmC
um
ula
tive
AV
sS
tead
y-s
tate
AV
s
B
0
20
40
60
80
100
Control Rm
% c
ells
with
nu
me
rou
s G
FP
-LC
3
va
cuo
les
Steady-state AVs
Cumulative AVs
*
**
9.3
42.3 ***
FIG. 19. Basal and rapamycin-activated autophagic activity in full medium. (A) GFP-LC3 transfected HL-1 cells were treated with 1 µM rapamycin for 30 min in full medium (FM). Z-stacks of representative cells were acquired at 60x magnification and subsequently processed by 3D blind deconvolution (AutoQuant). Shown are the maximum projections of total cellular GFP-LC3 fluorescence. (B) The percentage of cells with high numbers of AVs without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors was quantified (*p<0.05; **p<0.01; ***p<0.001).
IV-2.2 Autophagic response to nutrient deprivation
Autophagy is strongly upregulated in response to nutrient deprivation (Kim and
Klionsky, 2000). GFP-LC3-expressing HL-1 cells were incubated in glucose-containing
RESULTS: Quantifying autophagic activity
IV
69
Krebs-Henseleit (KH) solution, which deprives the cells of amino acids and serum,
without and with the lysosomal inhibitors (Fig. 20A, B). Similar to the results in full
medium, low steady-state levels of AVs were detected in KH alone, yet lysosomal
inhibition revealed robust levels of autophagic flux in almost all cells, with ~90% of cells
displaying high AV levels. A remainder of ~10% was inhibitor-insensitive. These
results indicate that, as expected, autophagic flux was substantially upregulated in
response to a low nutrient environment.
KH KH + i
0
20
40
60
80
100
120
KH
% c
ells
with n
um
ero
us G
FP
-LC
3
vacuo
les
Steady-state AVs
Cumulative AVs
A
B
FIG. 20. Autophagic flux under nutrient deprivation. (A) Shown are maximum projections of Z-stacks taken of GFP-LC3 fluorescence in cells incubated in KH for 2 h without and with lysosomal inhibitor cocktail. Without lysosomal inhibition cells typically displayed low steady-state AV contents (left panel). However, in the presence of the inhibitor cocktail cells accumulated numerous AVs revealing high autophagic flux (right panel). (B) The percentage of cells with high numbers of AVs without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors was quantified (*p<0.001).
RESULTS: Quantifying autophagic activity
IV
70
IV-2.3 Molecular perturbation of the autophagic pathway
During formation of the pre-autophagosomal structure, the C-terminal glycine of Atg12
forms a bond with Atg5 lysine 130. Replacing Atg5 lysine 130 with arginine (Atg5K130R
)
renders Atg5 unable to accept Atg12, and thus blocks AV formation, including LC3
recruitment (Mizushima et al., 2001). In order to enable molecular perturbation of the
autophagic pathway, we generated and characterized fusion proteins of the monomeric
red fluorescent protein mCherry (Shaner et al., 2004) and Atg5 or the dominant negative
mutant of Atg5, Atg5K130R
. Autophagic flux was determined under full medium and KH
solution conditions in HL-1 cells co-transfected with GFP-LC3 and either mCherry,
mCherry-Atg5 or mCherry-Atg5K130R
(Fig. 21A). Expression of mCherry-Atg5 did not
significantly influence autophagic flux in either high or low nutrient conditions when
compared to control (mCherry-expressing) cells. However, expression of mCherry-
Atg5K130R
significantly reduced both steady-state and lysosomal inhibitor-sensitive
accumulation of AVs in low nutrient conditions. This trend, although insignificant, was
also observed under high nutrient conditions. Moreover, high resolution imaging
indicated that AV formation was interrupted by mCherry-AtgK130R
(Fig. 21B). In
response to nutrient starvation, GFP-LC3-labeled punctae were smaller in mCherry-
AtgK130R
cells than in control or mCherry-Atg5 cells, indicative of failed pre-
autophagosome maturation (Mizushima et al., 2001).
RESULTS: Quantifying autophagic activity
IV
71
0
20
40
60
80
100
Vector Atg5 Atg5 Vector Atg5 Atg5
% c
ells
with n
um
ero
us G
FP
-LC
3
vacuo
les
Steady-state AVs Cumulative AVs
K130R K130R
FM KH
**
14.218.4
8.3
81.072.5
34.9
*
A
B
FIG. 21. Atg5 control of autophagosome formation. HL-1 cells were co-transfected with GFP-LC3 and either mCherry (empty vector control), mCherry-Atg5 or mCherry-Atg5
K130R. Cells were
incubated in KH solution, with or without lysosomal inhibitors for 3.5 h, at which time the cells were formaldehyde-fixed. (A) Autophagic flux was quantified via scoring of mCherry-positive cells with numerous GFP-LC3 vacuoles without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors. Represented is the percentage of cells with numerous GFP-LC3 vacuoles per total cells scored (*p<0.05; **p<0.001 (flux: Vector vs. Atg5
K130R in KH)). (B) Representative
images of the autophagic response are shown.
RESULTS: Quantifying autophagic activity
IV
72
Together, these results demonstrate that, contrary to current assumptions,
autophagic activity and AV content are not necessarily correlated, either positively or
negatively. Low levels of autophagy (full medium), high levels of autophagy (nutrient
deprivation) and impaired autophagy (mCherry-Atg5K130R
), are all reflected in low
steady-state presence of GFP-LC3-labeled AVs. However, the use of lysosomal
inhibitors revealed substantial differences in actual autophagic flux and thus is necessary
in order to quantify autophagic activity.
Interestingly, the maximal percentage of cells responding to nutrient deprivation
or rapamycin was ~90%, indicating that ~10% of cells lack the capacity for AV
generation. Similarly, ~10% of cells displayed high steady-state levels of AVs. AV
presence in this subpopulation may indicate disrupted autophagic flux. Therefore, ~80%
of HL-1 cells have the capacity to mount an autophagic response.
IV-2.4 Beclin1 control of the autophagic response to nutrient deprivation is dependent on a functional Bcl-2/-xL binding domain
Having established a novel sensitive method to quantify the autophagic response in a
population of cells, in response to both acute activation (rapamycin) and genetic
disruption (Atg5K130R
), we investigated the control of Beclin1 and its binding partners,
Bcl-2, on autophagic activity.
Beclin1 was the first mammalian protein described to mediate autophagy (Liang
et al., 1999). Beclin1 interacts with the class III PI3-K Vps34, regulating the formation
of the lipid second messenger phosphatidylinositol 3-phosphate (PI3-P) which is required
for activating the autophagic pathway (Kihara et al., 2001). Beclin1 contains a Bcl-2-
binding domain which has been shown to interact with anti-apoptotic Bcl-2 and Bcl-xL,
but not pro-apoptotic Bcl-2 family members (Liang et al., 1998). However, the nature of
the relationship between Beclin1 and Bcl-2 remains unclear. Recent work has implicated
Bcl-2 in the suppression of starvation-induced autophagy (Pattingre et al., 2005), yet
others have shown that Bcl-2 positively regulates autophagic cell death activated by
etoposide (Shimizu et al., 2004).
Here we sought to determine the effect of Beclin1 and a mutant form of Beclin1
lacking the Bcl-2 binding domain (Beclin1∆Bcl2BD) on autophagic activity, under high
RESULTS: Quantifying autophagic activity
IV
73
and low nutrient conditions. Under high nutrient conditions, steady-state and cumulative
autophagy were similar in control cells and Beclin1-transfected cells (Fig. 22A). In KH
solution, both control and Beclin1-overexpressing cell populations responded maximally
to nutrient deprivation. Beclin1∆Bcl2BD expression significantly reduced the percentage
of cells with autophagic flux in low nutrient conditions, indicating that Beclin1-mediated
autophagy required the presence of Bcl-2/-xL for maximal autophagic response.
Consistent with a failed response to trigger AV formation, Beclin1∆Bcl2BD expression
resulted in the formation of small GFP-LC3 ‘speckles’, similar to that observed in cells
expressing Atg5K130R
(Fig. 22B).
IV-3 Bcl-2 suppression of the autophagic response to nutrient deprivation
is dependent on its subcellular localization
Our ability to quantify autophagic flux (versus the commonly reported AV content)
revealed the surprising finding that Beclin1∆Bcl2BD suppressed autophagy.
Beclin1∆Bcl2BD, as well as other Beclin1 mutants lacking Bcl-2 interaction, increased
steady-state AV levels in cancer cells and have been shown to activate cell death during
nutrient deprivation, presumably due to overactive autophagy. Furthermore, Bcl-2 was
found to suppress steady-state AV levels presumably through its interaction with the
Beclin1 Bcl-2 binding domain (Pattingre et al., 2005).
To unravel the reasons for this discrepancy, we investigated the effect of Bcl-2
overexpression on the autophagic response to nutrient deprivation (Fig. 23). Although
we found that Beclin1∆Bcl2BD expression greatly reduced the autophagic response, we
detected a minor but statistically significant suppressive effect on autophagy by
overexpression of wild-type (WT-) Bcl-2. Endogenous Bcl-2 is found in the cytosol, at
the mitochondria, and at the S/ER (Lithgow et al., 1994). Forced localization of Bcl-2 to
the S/ER was shown to be responsible for the suppression of AV formation in response
to nutrient deprivation (Pattingre et al., 2005). We found that similar to the findings with
WT-Bcl-2, mitochondrial- (mito-)targeted Bcl-2 only slightly suppressed the autophagic
response. However, S/ER-targeted Bcl-2 potently decreased the percentage of cells
exhibiting autophagic activity in response to nutrient deprivation by about ~50%.
RESULTS: Quantifying autophagic activity
IV
74
0
20
40
60
80
100
Vector Beclin1 Beclin1∆Bcl2BD
Vector Beclin1
% c
ells
with
nu
me
rou
s G
FP
-LC
3
vacuo
les
Steady-state AVs Cumulative AVs
Beclin1∆Bcl2BD
FM KH
*
15.7
10.4
5.6
80.378.2
42.9
Vector Beclin1 Beclin1∆Bcl2-BD
A
B
KH
+ i
FIG. 22. Beclin1 regulation of the autophagic response. HL-1 cells co-transfected with GFP-LC3 and either a plasmid encoding Beclin1, Beclin1∆Bcl2BD or empty vector (control). Cells were incubated in either the high-nutrient full medium (FM) or low nutrient KH solution. Cells were incubated either without or with the lysosomal inhibitor cocktail for 3.5 h and formaldehyde-fixed. (A) Autophagic flux was determined via fluorescent imaging of GFP-LC3-II without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors. Represented is the percentage of cells with numerous GFP-LC3 vacuoles per total cells scored (*p<0.01 (flux: Vector vs. Beclin1 ∆Bcl2BD)). (B) Maximum projections of Z-stacks of representative cells in each condition are shown.
RESULTS: Quantifying autophagic activity
IV
75
0
20
40
60
80
100
Vector WT-Bcl2 Mito-Bcl2 S/ER-Bcl2
% c
ells
with
num
ero
us G
FP
-LC
3
va
cu
ole
s
Steady-state AVs Cumulative AVs
**78.5
67.9 73.5
38.2
* *
FIG. 23. Bcl-2 control of autophagic activity. HL-1 cells were transfected with GFP-LC3 and either empty vector, mito-Bcl-2, wild type Bcl-2, or S/ER-Bcl-2 constructs. Cells were incubated for 3.5 h in KH solution, without and with lysosomal inhibitors, at which time they were fixed by formaldehyde (4%). The percentage of cells displaying high levels of AVs was quantified under all conditions (*p<0.05; **p<0.001 (cumulative AVs vs. Vector)).
IV-4 Bcl-2 overexpression inhibits autophagy due to depletion of
sequestered S/ER Ca2+ stores
The strong suppressive effect on autophagy exerted by Beclin1∆Bcl2BD, the minimal
suppressive effect of wild-type Bcl-2, together with the profound suppressive effect of
S/ER-targeted Bcl-2 were not compatible with Bcl-2 functioning simply as a direct
suppressor of Beclin1 activity. These conflicting results suggested the presence of an
additional mechanism controlling autophagic activity. At the S/ER, Bcl-2 is involved in
the regulation of Ca2+
homeostasis. Bcl-2 increases the permeability of the S/ER to Ca2+
(Foyouzi-Youssefi et al., 2000) through its interaction with sarco/endoplasmic reticulum
Ca2+
ATPase (SERCA), which is responsible for pumping Ca2+
from the cytosol back
into the S/ER (Dremina et al., 2004). Intriguingly, S/ER Ca2+
stores are required for the
activation of autophagy (Gordon et al., 1993) as well as downstream lysosomal function
(Hoyer-Hansen et al., 2005). We hypothesized that Bcl-2 targeted to the S/ER inhibits
autophagy in part due to modulation of the S/ER Ca2+
content.
RESULTS: Quantifying autophagic activity
IV
76
We first sought to determine whether overexpression of Bcl-2 significantly
reduced Ca2+
content in the HL-1 cardiac cell. S/ER Ca2+
homeostasis is maintained by a
concerted action of release by ryanodine receptor and re-uptake by SERCA.
Thapsigargin (TG), a selective SERCA inhibitor (Thastrup et al., 1990), can be used to
deplete S/ER Ca2+
stores, by blocking re-uptake (Thastrup et al., 1990). S/ER Ca2+
content was inferred by measuring the increase in cytosolic Ca2+
after TG treatment using
fluorescent Ca2+
indicator Fluo-4 (Fig. 24A, B). TG-mediated depletion of S/ER Ca2+
was similar between WT-Bcl-2 and control cells, but was significantly reduced in cells
expressing S/ER-Bcl-2. These results demonstrate that the capacity for S/ER Ca2+
release, an index of S/ER Ca2+
levels, is reduced by S/ER-Bcl-2 in the HL-1 cardiac
myocyte.
-20
-10
0
10
20
30
40
Vector WT-Bcl-2 Mito-Bcl-2 ER-Bcl-2
% T
G-in
duced
ch
ang
e in F
luo-4
fluore
scence
A B
S/
+ TGFluo-4
Vector
WT
S/ER
*
**
FIG. 24. Bcl-2 reduces S/ER Ca2+
content. HL-1 cells were co-transfected with mito-CFP and either WT-Bcl-2 or S/ER-Bcl-2. Cells were incubated with 2 µM Fluo-4 and solution was replaced with dye-free KH solution, containing norepinephrine (100 µM) to stimulate Ca
2+ release. 10
images were collected prior to the addition of 1 µM thapsigargin (TG), at 1 image/sec. (A) Representative images. (B) The average percent change in Fluo-4 fluorescence was calculated (*p<0.01; **p<0.001).
IV-5 Positive regulation of autophagy by S/ER Ca2+
Consistent with previous reports (Dremina et al., 2004; Palmer et al., 2004), we found
that in HL-1 cardiac myocytes, S/ER-targeted Bcl-2 depleted Ca2+
content in the S/ER.
RESULTS: Quantifying autophagic activity
IV
77
We then sought to determine whether low levels of intracellular Ca2+
influence the
activation of autophagy by nutrient deprivation. BAPTA-AM (25 µM), a membrane
permeable Ca2+
chelator (Tsien, 1980), was applied to HL-1 cells, and autophagic flux
was quantified. BAPTA-AM treatment resulted in complete inhibition of autophagic
activity (Fig. 25A). Moreover, BAPTA-AM decreased autophagy in the presence of
rapamycin (1 µM; results not shown).
To determine whether S/ER Ca2+
content affected autophagic activity, we
depleted S/ER Ca2+
with TG. In control, WT-Bcl-2, mito-Bcl-2, and S/ER-Bcl-2 cells,
TG (1 µM) significantly suppressed nutrient deprivation-induced autophagic activity by
70-80%. Furthermore, in cells expressing S/ER-Bcl-2, TG reduced autophagic activity to
zero (cumulative AVs + TG equaled S/ER-Bcl-2 steady-state AVs) (Fig. 25B).
0
20
40
60
80
100
KH Control KH + BAPTA
% c
ells
with
num
ero
us G
FP
-LC
3
va
cu
ole
s
Steady-state AVs
Cumulative AVs
75.1
5.1
*
A
0
20
40
60
80
100
Vector WT-Bcl2 Mito-Bcl2 S/ER-Bcl2
% c
ells
with n
um
ero
us G
FP
-LC
3
vacuole
s
Cumulative AVs Cumulative AVs + TG
** *
*
B
FIG. 25. Role of S/ER Ca
2+ stores on nutrient deprivation induced autophagy. HL-1 cells
were transfected with GFP-LC3. Cells were incubated in the absence or presence of either (A) BAPTA-AM (25 µM) or (B) TG (1 µM) for 3.5 h in KH solution, without or with lysosomal inhibitors, at which time they were fixed with formaldehyde (4%). The percentage of cells displaying high levels of AVs was quantified ((A) *p<0.01; (B) *p<0.001 (vs. respective cumulative AVs w/o TG)). .
Chapter 5
Enhancing Macroautophagy Protects Against
Ischemia/Reperfusion Injury in HL-1 Cardiac Myocytes
________________________________________________________________________
Adapted from: Hamacher-Brady A, Brady NR, and Gottlieb RA. “Enhancing macroautophagy
protects against ischemia/reperfusion injury in cardiac myocytes.” Submitted.
RESULTS: Autophagy protects against sI/R
V
81
Cardiac myocytes undergo PCD as a I/R, resulting in reduced heart function. One feature
of I/R injury is the increased prevalence of autophagosomes. However, to date it is not
known whether autophagy functions as a protective pathway, contributes to PCD, or is a
non-relevant event during myocardial I/R injury. Autophagy may be a protective
response to I/R injury, as increased presence of autophagosomes has been documented in
response to sub-lethal ischemia in the perfused heart (Decker and Wildenthal, 1980).
Moreover, it was recently reported that enhanced levels of Beclin1 in the heart correlated
with the onset of protection in an in vivo model of myocardial stunning (Yan et al.,
2005).
V-1 Cellular autophagosomal content is increased during the early phase
of sI/R injury
We used HL-1 cells to explore the role of autophagy during sI/R injury. To determine if
autophagic activity is modulated in response to sI/R, we first characterized changes in
cellular autophagosomal content using high-resolution 3D-imaging of GFP-LC3. We
transfected HL-1 cardiac myocytes with GFP-LC3 and compared the abundance of AVs
in cells subjected to sI/R to normoxic control cells. Under normoxic conditions in KH
solution, GFP-LC3 was diffusely distributed throughout the cell, with very few detectable
AVs (Fig. 26A, upper panel). Cells subjected to sI/R, however, displayed increased
numbers of AVs (Fig. 26A, bottom panel). In addition, in control cells the few pre-
existing AVs were randomly distributed, while AVs in cells subjected to sI/R were
typically more clustered at the center of the cell. This distinctive distribution contrasts
with the autophagic response to starvation in hepatocytes, where no such clustering was
observed (Kochl et al., 2006).
To quantify the increase in GFP-LC3-labeled AVs, the percentage of cells
displaying numerous punctate GFP-LC3 structures was determined. Only a small
fraction of cells displayed punctate GFP-LC3 fluorescence when incubated in fully
supplemented medium or KH solution (Fig. 26B). In cells subjected to sI/R, however, the
number of cells with numerous AVs was significantly increased (Fig. 26B). Quantitative
analysis performed on Z-stacks of GFP-LC3 fluorescence revealed that sI/R significantly
RESULTS: Autophagy protects against sI/R
V
82
increased the number of AVs per cell and, likewise, the total autophagosomal volume
(Fig. 26C).
0
5
10
15
20
25
30
Normoxic sI/R
AV
vo
lum
e p
er
ce
ll [u
m2
]
0
5
10
15
20
25
30
Normoxic sI/R
Nu
mb
er
of A
Vs p
er
ce
ll
0
10
20
30
40
50
60
70
80
90
100
FM KH sI/R
% c
ells
with G
FP
-LC
3 v
acu
ole
s
A B
C *
*
*
(1.5h reperfusion)
Autophagosomalvolume/cell XY
XZ
ZYXY
XZ
ZY
XY
XZ
ZYXY
XZ
ZY
Normoxic
sI/R
Autophagosomalvolume/cell XY
XZ
ZYXY
XZ
ZY
XY
XZ
ZYXY
XZ
ZY
Normoxic
sI/R
FIG. 26. Analysis of cellular autophagosomal content during sI/R. GFP-LC3 expressing cells were subjected to 2 h ischemia and 1.5 h reperfusion. The extent of autophagy was assessed by the intracellular distribution of GFP-LC3. (A) Z-stacks of representative cells were acquired at
60x magnification with 0.3 µm increments to capture the total autophagosomal population of a cell. Shown are the maximum projections of total cellular GFP-LC3 fluorescence in the XY, XZ and YZ planes. (B) Cellular AV content in a population of cells was quantified and represented as the percentage of cells with numerous GFP-LC3 vacuoles at 1.5 h reperfusion (*p<0.05). FM, full medium. (C) Quantification of intracellular autophagy of single cells was performed via 3D analysis of representative Z-stacks. Shown are the average number of autophagosomes per cell (left panel) and the average autophagosomal volume per cell (right panel). sI/R significantly increased levels of autophagy in single cells (*p<0.01).
RESULTS: Autophagy protects against sI/R
V
83
V-2 Changes in autophagic activity during ischemia an reperfusion
We subsequently addressed the effect of sI/R on actual autophagic activity. Our results
above (V-1) demonstrate that cellular AV content was increased early in the reperfusion
period. However, a central finding of Chapter II was that steady-state levels of AVs do
not reflect autophagic flux. Thus, the increased presence of AVs observed during sI/R
may either be a sign of (i) enhanced formation of AVs, (ii) impaired fusion of AVs with
lysosomes to generate autophagolysosomes, or (iii) a combination of both. To
characterize autophagic activity in sI/R we therefore determined two relevant parameters
of autophagosome-lysosome fusion: the index of LC3-II degradation (autophagic flux)
and downstream lysosomal activity.
V-2.1 Flux of LC3-II degradation during sI/R
Using our previously established (Chapter II) approach based on the inhibition of
downstream lysosomal degradation of AVs and their cargo, we determined whether the
increase in cellular AVs during sI/R was indicative of increased or impaired autophagy.
Cells were subjected to various experimental conditions and treated with a cocktail of
lysosomal inhibitors to inhibit autophagolysosome formation (with bafilomycin A1) and
lysosomal protease activity (with E64D and pepstatin A). By analyzing the lysosomal
inhibitor-mediated increase in GFP-LC3-II (AV) accumulation within a cell population
we were able to obtain a quantitative index of the flux of AV formation and degradation.
Bar graphs depict the percentage of cells exhibiting high AV levels in the absence and
presence of lysosomal inhibitors, per condition. The difference between the two bars (see
values in graphs) is a measure of the percentage of cells demonstrating high autophagic
activity, or flux.
As reported in Chapter IV, in KH solution AV content was dramatically increased
in the presence of inhibitors (IV-2.2). Thus, under control conditions in KH solution,
which lacks the serum and amino acid component of full medium, autophagy was
strongly active. sI/R augmented the number of cells with increased numbers of AVs (Fig.
27A). Under lysosomal inhibition the number of cells with high AV content was
increased only slightly more, indicating that the previously described steady-state
increase in cellular AV content in sI/R (Fig. 26 and 27A) is a reflection of an
accumulation of AVs, presumably due to impairment in the autophagic pathway at a
RESULTS: Autophagy protects against sI/R
V
84
point(s) following AV formation and before AV degradation. As the level of AV
accumulation was substantially smaller than the inhibitor-mediated response seen in KH
solution for the same period of time, it can be concluded that autophagy is also impaired
at the level of AV formation.
A
0
20
40
60
80
100
KH sI/R sI/R Normox
% c
ells
with
nu
me
rou
s G
FP
-LC
3
vacu
ole
s
Steady-state AVs Cumulative AVs
**
*63.3
12.4
56.1
B
*
**
0
20
40
60
80
100
KH ISCH ISCH Normox
% c
ells
with
nu
me
rou
s G
FP
-LC
3
vacu
ole
s
Steady-state AVs Cumulative AVs
74.11.8
39.1
FIG. 27. Flux of LC3-II degradation during sI/R. (A) Inhibitor-sensitive autophagy at 1.5 h reperfusion was quantified by determining the percentage of cells with numerous GFP-LC3-labeled AVs in each condition without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors present during reperfusion (cumulative AVs: *p<0.001 (KH vs. ISCH); **p<0.01 (KH vs. ISCH Normox)). sI/R ‘Normox’, ischemia-mimetic solution in presence of oxygen. (B) GFP-LC3-expressing cells were fixed immediately following 2 h ischemia without and with presence of lysosomal inhibitors and autophagic flux was determined as described above (*p<0.01, steady-state AVs (KH vs. sI/R); **p<0.05, cumulative AVs (KH vs. sI/R)). Lysosomal inhibitors were present throughout ischemia. ISCH, ischemia; ISCH ‘normoxic’, ischemia-mimetic solution in presence of oxygen.
Most AVs were formed during the reperfusion period, as cells fixed immediately
after the ischemic period were essentially devoid of AVs, either with or without
RESULTS: Autophagy protects against sI/R
V
85
lysosomal inhibitors, indicating a complete blockage of autophagy during the ischemic
period (Fig. 27B). Interestingly, hypoxia was a necessary component of the insult, as
cells incubated in ischemia-mimetic solution alone, under normoxic conditions, exhibited
only a minor reduction of autophagic flux which recovered completely upon reperfusion
(Fig. 27A).
V-2.2 Lysosomal activity during sI/R
One possible explanation for the observed accumulation of AVs during sI/R was a non-
functional lysosomal compartment. To investigate downstream lysosomal activity, HL-1
cells were incubated in LysoTracker Red (LTR), which labels the highly acidic lysosomal
vacuoles and thus reports activity of the vacuolar H+-ATPase (v-ATPase). Before and
after sI/R, we observed similar patterns of LTR fluorescence, indicating that, consistent
with its importance in cell survival during I/R (Karwatowska-Prokopczuk et al., 1998),
activity of the v-ATPase is maintained during the reperfusion period (Fig. 28A).
Furthermore, we determined the activity and subcellular localization of cathepsin
B, a predominant lysosomal protease, using a MagicRed substrate which fluoresces when
cleaved by cathepsin B (Lamparska-Przybysz et al., 2005). We did not detect a decrease
in cathepsin B activity following sI/R, as MagicRed fluorescence was still punctate
(lysosomal) and displayed an intensity comparable to the normoxic control (Fig. 28B).
Moreover, we found that cathepsin B activity was not detected in the cytosol, indicating
that cathepsin B is not released from the lysosomes following sI/R. Together, these
results indicate a functional lysosomal compartment during our experiments.
FIG. 28. (Next page) Assessment of lysosomal activity and participation in pro-death signaling. Representative images were aquired at 40x magnification under the exact same conditions to ensure comparability. Multicolour look-up-tables were applied to grey scale images to visualize the range of fluorescence intensities with black representing lowest pixel values and white representing highest pixel values. (A) Cells were subjected to the experimental conditions and then stained with 50 nM LTR. Shown are maximum projections of total cellular LTR fluorescence in control cells (KH), cells subjected to 2 h ischemia followed by 1.5 h reperfusion (sI/R), and cells incubated in bafilomycin A1-containing KH solution (KH + Baf A1) to exemplify LTR staining during compromised vacuolar H
+-ATPase activity. (B) Cells were loaded with
MagicRed cathepsin B substrate during the last 30 min of the experiment. Shown are maximum projections of MagicRed stacks in control cells (KH), cells subjected to 2 h ischemia followed by 1.5 h reperfusion (sI/R), and cells incubated in lysosomal inhibitor-containing KH solution (KH + i) to illustrate MagicRed staining under cathepsin B inhibition. Similar results were obtained with LTR and MagicRed after 5 h reperfusion (data not shown).
RESULTS: Autophagy protects against sI/R
V
86
A
B
KH sI/R
KH sI/R
Mag
icR
ed
LT
R
KH + Baf A1
KH + i
V-3 Unraveling the role of autophagy in sI/R injury
The above results demonstrate that formation of AVs is suppressed during ischemia, and
that autophagic flux only partially recovers during reperfusion. As such, to determine
whether autophagy represents a protective response or a component of injury, we altered
the autophagic pathway using pharmacological and molecular perturbations at the levels
of induction and/or formation of AVs.
V-3.1 Pharmacological perturbation of autophagy induction influences sI/R injury
Phosphatidylinositol 3-kinases (PI3-K) exert opposing actions on the autophagic
pathway, with class I PI3-K inhibiting and class III PI3-K stimulating autophagy (Petiot
et al., 2000). The PI3-K inhibitors 3-methyladenine (3-MA) and wortmannin (Arcaro
and Wymann, 1993; Blommaart et al., 1997) are used as inhibitors of autophagy at the
sequestration step due to their inhibition of class III PI3-K (Seglen and Gordon, 1982;
Seglen and Bohley, 1992). Conversely, the inhibition of autophagy by class I PI3-K is
mediated through its downstream action on mammalian target of rapamycin (mTOR)
RESULTS: Autophagy protects against sI/R
V
87
which negatively controls autophagy. Inhibition of mTOR with the immunosuppressant
rapamycin results in the induction of autophagy (Blommaart et al., 1995; Noda and
Ohsumi, 1998; Ravikumar et al., 2006).
Cells were treated with either 10 mM 3-MA or 100 nM wortmannin, to inhibit
autophagy, or with 1 µM rapamycin, to enhance autophagy. To verify the effect on
autophagic flux, GFP-LC3 expressing cells were incubated with the indicated inhibitors
and autophagic flux was evaluated in KH solution. Both 3-MA and wortmannin
completely abolished autophagic flux in KH solution (Fig. 29A). During sI/R this was
reflected in a complete lack of AV accumulation in cells treated with 3-MA and
wortmannin (Fig. 29B). Treatment with rapamycin on the other hand increased autophagy
in KH solution at the level of AV formation (Fig. 29A). It can be concluded that
rapamycin-induced AV formation exceeds the capacity for AV degradation, since
although a maximal percentage of cells showed active autophagy as revealed by
lysosomal inhibition, the percentage of cells with high steady-state AVs increased
significantly. During sI/R, rapamycin-treated cells still displayed numerous AVs (Fig.
29B). Determination of autophagic activity during sI/R revealed that rapamycin did not
rescue autophagy during ischemia, but increased autophagic flux at 1.5 h reperfusion as
fewer cells displayed steady-state accumulation of AVs (Fig. 29C).
The effect of pharmacological interference with the activation of autophagy on
sI/R-induced cellular injury was evaluated based on mitochondrial clustering of GFP-Bax
(Fig. 30A). Under normoxic control conditions, over the duration of the experiment both
3-MA and wortmannin slightly increased basal levels of GFP-Bax clustering. Incubation
with 3-MA and wortmannin prior to and during sI/R resulted in a significant aggravation
of cellular injury.
Similarly, disruption of lysosome function increased sI/R injury. Under normoxic
control conditions lysosomal inhibition did not affect cell viability for up to 7 hours, as
assessed by GFP-Bax clustering (Fig. 30B). However, lysosomal inhibition significantly
increased GFP-Bax clustering following sI/R, indicating that lysosomal proteases do not
exert pro-apoptotic functions during sI/R but rather participate in the maintenance of cell
survival. In contrast, cells treated with rapamycin were significantly protected against
sI/R injury, suggesting that autophagy may serve a pro-survival role during sI/R injury.
RESULTS: Autophagy protects against sI/R
V
88
0
10
20
30
40
50
ISCH ISCH + Rm sI/R sI/R + Rm
% c
ells
with
nu
mero
us G
FP
-LC
3
va
cu
ole
s
Steady-state AVs Cumulative AVs
0.8 -0.7
16.6 21.9
0
20
40
60
80
100
Control Rm 3-MA Wm
% c
ells
with
nu
me
rou
s G
FP
-LC
3
vacu
ole
s
Steady-state AVs Cumulative AVs
78.1 58.7
0.5 -2.2
A
C
B
Control
Rm
3-MA
Wm
sI/R
*
*
FIG. 29. Pharmacologic interference with autophagy induction. Cells were pre-treated with the indicated inhibitors for 1 h in Claycomb medium prior to incubation in experimental conditions. Inhibitors were also present in both ischemic and reperfusion buffers. (A) GFP-LC3 expressing
cells were pre-treated with rapamycin (Rm, 1 µM), 3-MA (10 mM), or wortmannin (Wm, 100 nM) for 1 h in Claycomb medium and then incubated in KH solution with and without lysosomal inhibitors for 2 h. Rm, 3-MA, and Wm were also present during incubation in KH solution. The presence of punctate GFP-LC3-positive AVs was then assessed per incubation condition (*p<0.001). (B) Representative images of cells treated with the indicated inhibitors and subjected to sI/R are shown. (C) GFP-LC3 expressing cells were subjected to 2 h ischemia followed by 1.5 h reperfusion with and without rapamycin. Autophagic flux was then determined as described above (*p<0.05 (sI/R vs. sI/R + Rm flux).
RESULTS: Autophagy protects against sI/R
V
89
0
10
20
30
40
50
60
70
Control Rm 3-MA Wm
% c
ells
with
pun
cta
te G
FP
-Ba
x
KH sI/R
0
10
20
30
40
50
Control Lys. Inh's
% c
ells w
ith
pu
ncta
te G
FP
-Ba
x .
KH sI/R
*
A
B
*
*
**
†
**
FIG. 30. Effect of pharmacological interference upstream of AV formation on sI/R injury. (A) GFP-Bax expressing cells were pre-treated with the indicated inhibitors for 1 h in Claycomb medium prior to incubation in experimental conditions (Wm, wortmannin; Rm, rapamycin). Inhibitors were also present in both ischemic and reperfusion buffers. At 5 h of reperfusion, GFP-Bax expressing cells were classified as displaying diffuse cytosolic or punctate mitochondrial GFP-Bax localization. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (†p<0.05 vs. normoxic control; *p<0.05 and **p<0.001, vs. sI/R control). (B) GFP-Bax expressing cells were subjected to sI/R in the presence of the lysosomal inhibitor cocktail. At 5 h of reperfusion cells were classified as displaying diffuse cytosolic or punctate mitochondrial GFP-Bax localization. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (*p<0.05).
RESULTS: Autophagy protects against sI/R
V
90
V-3.2 Beclin1 protects from sI/R-activated injury and increases autophagic flux
The above results implicate autophagy as a protective response to I/R injury. However,
the pharmacological reagents employed are known to also exert effects unrelated to
autophagy (Caro et al., 1988; Brunn et al., 1996; Xue et al., 1999). We therefore sought
to confirm these findings by targeting specific proteins in the autophagic pathway.
Beclin1, which is endogenously expressed in HL-1 cells (Fig. 31A), is a necessary
participant in AV formation and also believed to take part in the trafficking of lysosomal
proteins (Liang et al., 1999; Kihara et al., 2001). We examined the effect of
overexpression of Beclin1 on sI/R-induced cellular injury. Similar to the protective
effect of rapamycin, cells which had been transiently transfected with Beclin1 were
significantly protected against sI/R-induced GFP-Bax clustering (Fig. 31B).
We subsequently reduced Beclin1 expression using the Block-iT miR RNAi
vector which bicistronically encodes for GFP as an expression marker. We found that 96
hours of expression were necessary in order to achieve a significant knock-down of
Beclin1 (Fig. 31C). Beclin1 silencing aggravated cellular injury after sI/R (Fig. 31D, E),
revealing that autophagic activity following sI/R, although somewhat impaired, is a
crucial component of the cell’s survival response.
FIG. 31. (Next page) Beclin 1 overexpression protects against sI/R injury. (A) Total Beclin1 expression levels were compared between whole cell lysates of control cells and cells transiently
transfected with flag-Beclin1 (61 kDa) or flag-Beclin1∆Bcl2BD (52 kDa) for 48 h. Immunodetection of total Beclin1 demonstrated successful overexpression of constructs. (B)
Cells were co-transfected with GFP-Bax and empty vector, flag-Beclin1, or flag-Beclin1∆Bcl2BD. At 5 h reperfusion, cellular injury was assessed by scoring cells with mitochondrial translocated GFP-Bax. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (*p<0.01). (C) Cells were transfected with a vector encoding RNAi against either Beclin1 or LacZ. Whole cell lysates were prepared after 96 h of expression (at which time transfection efficiency was ~30%) and used for immunoblot detection of protein downregulation. (D) For assessment of cellular injury, cells were co-transfected with mCherry-Bax and the RNAi vectors as indicated. Co-expression of mCherry-Bax and RNAi after 96 h was confirmed with the help of GFP which is bicistronically included in the RNAi vectors. (E) 96 h after transfection, cells were subjected to sI/R and GFP-positive cells with mitochondrial mCherry-Bax were scored and quantified as described above (*p<0.05).
RESULTS: Autophagy protects against sI/R
V
91
0
10
20
30
40
50
60
70
Vector Beclin1 Beclin1
∆Bcl2BD
% c
ells w
ith
pu
ncta
te G
FP
-Ba
x .
KH sI/R
0
10
20
30
40
50
LacZ RNAi Beclin1 RNAi% c
ells w
ith
pu
ncta
te m
Ch
err
y-B
ax . KH sI/R
A B
Beclin1
Beclin1∆Bcl2BD
Actin
Beclin
1∆
Bcl2
BD
Contr
ol
Beclin
1
Contr
ol
Actin
Beclin1
C DGFP-RNAi mCherry-Bax
E
Beclin
1 R
NA
i
LacZ
RN
Ai
Actin
Beclin1
*
*
RESULTS: Autophagy protects against sI/R
V
92
To determine if protection conferred by Beclin1 overexpression correlated with
increased autophagic flux, LC3 processing was quantified in cells expressing Beclin1
following sI/R. Fluorescence analysis of GFP-LC3 co-transfected cells revealed a
significant increase in autophagic flux after sI/R, as the percentage of cells with steady-
state accumulation of AVs was decreased (Fig. 32A).
The interaction between Beclin1 and the class III PI3-K, Vps34, is a prerequisite
for the induction of autophagy (Kihara et al., 2001), through the generation of
phosphatidylinositol 3-phosphate (PI3-P) which functions as a second messenger to
activate autophagy (Petiot et al., 2000). To obtain insight into the effect of Beclin1 on
the initiation of AV formation, we utilized GFP-2xFYVE, a sensor for the intracellular
presence and distribution PI3-P. The binding pocket of FYVE is specific for PI3-P
(Vieira et al., 2001), and upon generation of PI3-P, GFP-2xFYVE concentrates at sites of
production, allowing for a qualitative measure of PI3-P. Under control conditions (KH
solution) and at 1.5 h reperfusion, vesicular accumulation of GFP-2xFYVE was detected.
This labeling was dependent on PI3-K activity, as treatment with wortmannin resulted in
a homogenous distribution of GFP-2xFYVE. In KH solution and during reperfusion,
both control cells and cells overexpressing Beclin1 exhibited large clusters of GFP-
2xFYVE-labeled vesicles, indicating a robust generation of PI3-P (Fig. 32D).
V-3.3 Beclin1 protection against sI/R injury requires a functional Bcl-2 binding domain
Beclin1 contains a Bcl-2 binding domain which has been shown to interact with the anti-
apoptotic Bcl-2 family members Bcl-2 and Bcl-xL (Liang et al., 1998; Pattingre et al.,
2005). In Chapter IV we found that the autophagic response to starvation requires a
functional Beclin1 Bcl2 binding domain (IV-2.4). To determine whether the protection
conferred by Beclin1 following sI/R was regulated by the Bcl-2 family, we made use of a
Beclin1 deletion mutant, Beclin1∆Bcl2BD, which lacks the Bcl-2 binding domain (Liang
et al., 1998) (Fig. 31A), but still can function in autophagy induction (Pattingre et al.,
2005; Shibata et al., 2006). Beclin1∆Bcl2BD reduced autophagic activity during the
reperfusion period as reflected in a decreased percentage of cells with steady-state
accumulation of AVs as well as a complete absence of autophagic flux (Fig. 32A).
RESULTS: Autophagy protects against sI/R
V
93
Unlike overexpression of Beclin1, Beclin1∆Bcl2BD expression did not confer protection
against sI/R injury (Fig. 31B), confirming a cytoprotective role for autophagy.
Beclin1∆Bcl2BD may interfere with endogenous Beclin1 interaction with the PI3-K,
Vps34, as PI3P-induced GFP-2xFYVE clustering was decreased under control
conditions, and at 1.5 h reperfusion (Fig. 32B).
0
10
20
30
40
50
60
sI/R + Vector sI/R + Beclin1 sI/R + Beclin1
∆Bcl2BD
% c
ells
with
nu
me
rou
s G
FP
-LC
3
va
cu
ole
s
Steady-state AVs Cumulative AVs
19.5 31.3
8.1
A
B
*
**
KH
sI/
R
Vector Beclin1 Beclin1∆Bcl2BD
Wm
FIG. 32. Beclin1-mediated protection in sI/R correlates with its effect on autophagy. (A)
Cells were co-transfected with GFP-LC3 and empty vector, Beclin1, or Beclin1∆Bcl2BD. At 1.5 h reperfusion, autophagic flux was determined via fluorescent imaging of GFP-LC3-II without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors. Represented is the percentage of cells with numerous GFP-LC3 vacuoles per total cells scored (*p<0.01; **p<0.05; flux Vector vs. Beclin1: p<0.05). (B) Cells were co-transfected with GFP-2xFYVE and empty
vector, Beclin1, or Beclin1∆Bcl2BD and incubated in KH or subjected to 2 h ischemia followed by 1.5 h reperfusion. Shown are representative cells of each condition.
RESULTS: Autophagy protects against sI/R
V
94
V-3.4 Inhibition of Atg5 aggravates injury and counteracts protection conferred by Beclin1
We next sought to determine whether the protective effect exerted by Beclin1 was
specific to autophagy, or rather the result of a perturbation in the ratio of pro- and anti-
apoptotic Bcl-2 family members, via binding of Beclin1 to Bcl-2 and/or Bcl-xL. To do so
we targeted Atg5, a necessary component of the autophagic machinery downstream of
Beclin1 activity (Mizushima et al., 2001). We utilized mCherry-Atg5 and the dominant
negative mCherry-Atg5K130R
which were characterized in Chapter IV (IV-2.3).
Autophagic flux at 1.5 h following sI/R was virtually the same for cells
expressing mCherry-Atg5 and mCherry alone, suggesting that Atg5 is not a rate-limiting
factor in the autophagic response to sI/R. Conversely, mCherry-Atg5K130R
significantly
reduced autophagy during sI/R (Fig. 33A). To assess the consequence of reducing
autophagy via expression of mCherry-Atg5K130R
, HL-1 cells were co-transfected with
GFP-Bax and either mCherry-Atg5, mCherry-Atg5K130R
, or mCherry alone, and subjected
to sI/R (Fig. 33B). Consistent with the lack of an effect on autophagic flux, mCherry-
Atg5 expression did not affect sI/R-induced GFP-Bax activation. Similar to the results
obtained through silencing of Beclin1, mCherry-Atg5K130R
expression resulted in
increased GFP-Bax clustering, indicating that residual autophagic activity represents an
underlying protective response to sI/R.
Finally, to determine if Beclin1-mediated protection was due to its effect on
autophagy, we blocked autophagy with mCherry-Atg5K130R
in Beclin1 overexpressing
cells. Strikingly, protection resulting from Beclin1 expression was lost when co-
expressing mCherry-Atg5K130R
, indicating that Beclin1 protection is entirely linked to its
role in increasing autophagy (Fig. 33C).
RESULTS: Autophagy protects against sI/R
V
95
0
10
20
30
40
50
60
Vector Atg5 Atg5(K130R)% c
ells w
ith
pun
cta
te G
FP
-Bax . KH sI/R
0
10
20
30
40
50
60
70
80
Vector Beclin1 Beclin1 +
Atg5(K130R)
% c
ells w
ith
pu
ncta
te G
FP
-Bax .
KH sI/R
Figure 33. Hamacher
C
A
*
*
**
B
0
10
20
30
40
50
sI/R + Vector sI/R + Atg5 sI/R +Atg5(K130R)
% c
ells
with
num
ero
us G
FP
-LC
3
vacuole
s
Steady-state AVs Cumulative AVs
11.1 9.9
3.4
*
FIG. 33. Inhibition of Atg5 increases sI/R injury and abolishes protection through Beclin1. Cells were transfected with either (A) GFP-LC3 or (B) GFP-Bax together with mCherry-Atg5, mCherry-Atg5
K130R, or mCherry alone (Control) and allowed to express for 48 h. Co-expression
of GFP and mCherry was found to be >95%. (A) Autophagic flux at 1.5 h reperfusion was determined via scoring of mCherry-positive cells with numerous GFP-LC3 vacuoles without (steady-state AVs) and with (cumulative AVs) lysosomal inhibitors. Represented is the percentage of cells with numerous GFP-LC3 vacuoles per total cells scored (*p<0.01). (B) Cells were subjected to simulated ischemia followed by 5 h reperfusion, and cellular injury was assessed by scoring mCherry-positive cells with mitochondrial-translocated GFP-Bax. Represented is the percentage of cells with punctate GFP-Bax distribution per total cells scored (*p<0.01). (C) Cells were co-transfected with GFP-Bax and Beclin1 plus mCherry, Beclin1 plus mCherry-Atg5
K130R and subjected to sI/R 48 h after transfection. mCherry-positive cells with
mitochondrial GFP-Bax were scored and quantified as described above (*p<0.001; **p<0.05).
Chapter 6
Mitophagy as Part of the Autophagic Survival Response
during Simulated Ischemia/Reperfusion Injury in HL-1
Cardiac Myocytes
___________________________________________________________________
Adapted from: Hamacher-Brady A., Brady N.R., Logue S.E., Sayen M.R., Jinno M.,
Kirshenbaum L.A., Gottlieb R.A., and A.B. Gustafsson (2006). “Response to myocardial
ischemia/reperfusion injury involves autophagy and Bnip3.” Cell Death Differ., in press.
RESULTS: Mitophagy VI
99
The central importance of mitochondria in determining cell viability following I/R has
been increasingly recognized in recent years. Preservation of mitochondrial integrity is
essential for the survival of the cardiac myocyte as it guarantees the maintenance of the
cell’s energetic homeostasis, while compromised mitochondrial integrity ultimately leads
to the conversion of mitochondria into executers of programmed cell death. In Chapter
III we observed that mitochondrial networks of HL-1 cells fragmented during sI/R.
Reformation of the mitochondrial network correlated with cell viability, whereas
fragmented mitochondria eventually became targets of pro-apoptotic Bax. Autophagy is
a mechanism capable of removing organelles such as mitochondria (mitophagy) and, as
described in Chapter V, autophagy is a powerful protective pathway against I/R injury.
As mitochondrial dysfunction is a key component in I/R injury and ultimately
decides cell fate, we hypothesized that autophagy may help maintaining cell viability via
the selective scavenging of pro-apoptotic mitochondria. As such, autophagy would allow
a cardiac myocyte to remain viable up to a threshold, which would be a balance between
the removal of dysfunctional mitochondria and the ability of the remaining mitochondria
to meet the energetic demands of the cell. We speculated that in sI/R dysfunctional
mitochondria would be removed via autophagy. Using sI/R of the cardiac HL-1 cell line
as an in vitro model of I/R injury to the heart and overexpression of Bnip3 as a surrogate
for I/R-induced mitochondrial damage we investigated the relationship between
mitochondrial dysfunction and autophagy.
RESULTS: Mitophagy VI
100
VI-1 Fragmented mitochondria are targets of autophagy during
reperfusion
sI/R-activated mitochondrial fragmentation (Chapter III) coincides spatially with the
accumulation of AVs occurring at reperfusion (Chapter V), as both fragmented
mitochondria (Fig. 8A) and AVs (Fig. 26A) were predominantly present in perinuclear
regions.
Dysfunctional mitochondria can be removed from the cell via autophagy (Elmore
et al., 2001; Lemasters, 2005; Priault et al., 2005). Studies employing electron
microscopy have previously shown that mitophagy occurs in the heart. In the perfused
rabbit heart model, Decker and Wildenthal demonstrated that autophagic sequestration of
mitochondria was a prominent event during the reperfusion phase following a mild
hypoxic insult (Decker et al., 1980; Decker and Wildenthal, 1980). To investigate if
mitochondria were sequestered by autophagosomes in our model of sI/R, we performed
3D imaging of HL-1 cells co-transfected with mito-DsRed2 and GFP-LC3 in order to
detect mitochondrial autophagy with high spatial resolution.
Merged Z-stacks of mito-DsRed2 and GFP-LC3 fluorescence taken of live cells
after sI/R indicated the colocalization of mitochondria and AVs, as seen in the 3-plane
view of Fig. 34A. Detailed image analysis revealed that small mitochondrial fragments
were in fact present within the GFP-LC3 labeled structures, i.e. undergoing mitophagy
(Fig. 34B). Since autophagy is likely to fulfill functions in addition to the removal of
mitochondria, it is to be expected that not all autophagosomes contain mitochondria.
Furthermore, during the execution of mitophagy, once delivered to the lysosome, mito-
DsRed2 fluorescence is quenched at low pH and degraded by lysosomal proteases.
RESULTS: Mitophagy VI
101
XY
XZ
ZYXY
XZ
ZY
Mito-DsRed2 GFP-LC3 Merge
A
B
FIG. 34. sI/R leads to autophagic sequestration of fragmented mitochondria. HL-1 cells were co-transfected with mito-DsRed2 and GFP-LC3 to simultaneously visualize mitochondria and autophagosomes and subjected to 2 h ischemia in hypoxic pouches followed by reperfusion in normoxic KH solution. Live cells were then analyzed by fluorescence microscopy. (A) Shown
is the 3-plane view of a 3D deconvolved Z-stack acquired at 60x magnification with 0.3 µm increments at 90 min reperfusion. (B) 3D reconstructions of merged GFP-LC3 and mito-DsRed2 fluorescence were produced with ImageJ of a subcellular region with apparent colocalization of
mito-DsRed2 and GFP-LC3 (arrow in (a)). Scale bar, 1 µm.
RESULTS: Mitophagy VI
102
VI-2 Bnip3 overexpression as a surrogate for sI/R-induced mitochondrial
dysfunction
We hypothesize that mitophagy could constitute a cytoprotective mechanism during sI/R
via the selective scavenging of dysfunctional mitochondria. To test this hypothesis, we
employed overexpression of Bnip3 as a model for sI/R-activated mitochondrial
dysfunction.
Bnip3 is a pro-apoptotic member of the Bcl-2 family and is known to exert its
pro-apoptotic function by compromising mitochondrial integrity (Vande Velde et al.,
2000). Overexpression of Bnip3 has been shown to induce cell death related to MPTP
activation, increased ROS production and autophagic activity (Chen et al., 1997; Daido et
al., 2004; Kanzawa et al., 2005). As such, Bnip3 may be an important point of crosstalk
between the apoptotic and autophagic pathways. We speculated that Bnip3-induced
mitochondrial dysfunction was connected to its autophagy-inducing properties, rendering
it a suitable model to mimic and study the relationship between sI/R-induced
mitochondrial dysfunction and autophagy in isolation from other molecular events
occurring during sI/R.
Bnip3 is expressed at high levels in the adult myocardium and contributes to I/R-
induced mitochondrial dysfunction in the ex vivo heart (Hamacher-Brady et al., 2006).
First, we verified that similarly Bnip3 contributes to sI/R injury in HL-1 cells using RNAi
knockdown of Bnip3 (Fig. 35A). Cells transfected with RNAi directed against Bnip3
were significantly protected against sI/R-induced GFP-Bax activation (Fig. 35B),
demonstrating that Bnip3 is a mediator of injury in our in vitro model of sI/R.
RESULTS: Mitophagy VI
103
A
0
10
20
30
40
50
LacZ RNAi Bnip3 RNAi
% c
ells w
ith
pu
ncta
te G
FP
-Ba
x .
KH sI/R
*
B
FIG. 35. Bnip3 mediates sI/R injury in the HL-1 cardiac myocyte. (A) Cells were transfected with RNAi directed against LacZ, as a control, or Bnip3. 48 h after transfection, cell lysates were analyzed for Bnip3 content via Western blotting. (B) Cells were co-transfected with GFP-Bax and RNAi against LacZ or Bnip3. After 48 h of expression, cells were subjected to sI/R and GFP-Bax clustering was analyzed (*p<0.01).
Furthermore, overexpression of Bnip3 resulted in cell death over extended periods
of time, detectable over 24-72 h (Fig. 36), indicating that overexpression of Bnip3 is
sufficient to exert its pro-apoptotic function.
0
10
20
30
40
50
24 h 48 h 72 h
% c
ell d
ea
th
Control Bnip3
FIG. 36. Bnip3 overexpression activates cell death in HL-1 cardiac myocytes. Cells were transfected with either empty vector (Control) or Bnip3 and cell death was monitored using YoPro1 as a vital exclusion dye. Similar results were obtained in three independent experiments.
RESULTS: Mitophagy VI
104
VI-3 Bnip3 induces autophagy in cardiac HL-1 cells
A unique feature of Bnip3 is its C-terminal transmembrane (TM) domain which is
required for its pro-apoptotic function, including its targeting to the mitochondria (Chen
et al., 1997; Yasuda et al., 1998). Bnip3∆TM, which lacks this transmembrane domain,
has been shown to act as a dominant negative, blocking Bnip3-induced cell death
(Kubasiak et al., 2002; Regula et al., 2002; Kothari et al., 2003). Accordingly, we used
Bnip3∆TM expression to investigate the effects of Bnip3 on mitochondria.
To investigate the link between I/R-induced autophagy and Bnip3 activation, HL-
1 cells were transiently transfected with wild type Bnip3 or Bnip3∆TM. The level of
autophagy was assessed under normoxic conditions in full medium. As shown in Fig.
37A and B, overexpression of Bnip3 caused a significant increase in the steady-state
levels of AVs compared to control cells. In contrast, Bnip3∆TM-transfected cells did not
show a significant increase in AV levels. As demonstrated in Chapters IV and V,
increased basal levels of AVs do not sufficiently report autophagic activity. To
investigate if the Bnip3-induced increased number of AVs reflected increased autophagic
flux or an accumulation of AVs due to compromised downstream degradation, we
employed inhibition of lysosomal activity. As introduced in Chapter IV, the difference
between the accumulation of GFP-LC3-labeled AVs under steady-state conditions and
conditions of lysosomal inhibition serves as a quantitative index of autophagic activity.
We found that Bnip3 increased both AV formation and autophagic flux (Fig. 37C).
RESULTS: Mitophagy VI
105
A
B C
Control Bnip3 Bnip3∆TM
0
20
40
60
80
100
pcDNA3.1 Bnip3
% c
ells
with
num
ero
us G
FP
-LC
3
va
cu
ole
s
Steady-state AVs
Cumulative AVs
**
0
20
40
60
80
Control Bnip3
% c
ells
with
nu
me
rou
s G
FP
-LC
3va
cu
ole
s
Bnip3∆TM
*
Control
FIG. 37. Bnip3 overexpression increases autophagic flux in full medium. (A) HL-1 cells
were co-transfected with GFP-LC3 and empty vector (Control), Bnip3, or Bnip3∆TM. After 48 h, the extent of autophagy was assessed by analyzing staining patterns of GFP-LC3. (B) Quantification of autophagy in transfected cells. Overexpression of Bnip3 in cardiac myocytes significantly increased the abundance of AVs (*p<0.05). (C) HL-1 cells were co-transfected with GFP-LC3 and empty vector (Control) or Bnip3. 48 h following transfection, cells were incubated with the lysosomal inhibitor cocktail for 7 h in full medium. Quantification of autophagic flux demonstrates that lysosomal inhibitors dramatically increased the abundance of AVs, and that Bnip3 increased autophagic flux (p<0.01).
In addition, we stained Bnip3-transfected cells with LysoTracker Red (LTR) to
monitor activity of the lysosomal compartment. We found co-localization of GFP-LC3
and LTR, indicating fusion between autophagosomes and lysosomes (Fig. 38). No
differences were observed in total LTR staining between control and Bnip3-
overexpressing cells (data not shown). Notably, LTR staining was dispersed throughout
the cell in control cells, but was more concentrated to regions of high autophagosomal
content in Bnip3 overexpressing cells.
RESULTS: Mitophagy VI
106
GFP-LC3
LTR
FIG. 38. Fusion between AVs and lysosomes seems functional in Bnip3-overexpressing cells. 48 h following co-transfection with GFP-LC3 and Bnip3, HL-1 cells were loaded with 50 nM LTR. Co-localization of LysoTracker Red (LTR) and GFP-LC3 demonstrates formation of autophagolysosomes. LTR staining was prominent in the area containing
autophagosomes. Scale bar, 10 µm.
VI-4 Bnip3 causes autophagy of mitochondrial fragments
Several studies have reported that Bnip3 overexpression causes mitochondrial
dysfunction. Closer examination of mitochondria in Bnip3-transfected cells revealed a
widespread fragmentation of the mitochondrial network, whereas cells transfected with
vector or Bnip3∆TM had typical filamentous mitochondria (Fig. 39).
Control Bnip3 Bnip3∆TM
FIG. 39. Bnip3 overexpression results in fragmentation of the mitochondrial network. Cells
were co-transfected with mito-DsRed2 and vector (Control), Bnip3, or Bnip3∆TM and images were acquired of live cells 48 h after transfection. Shown are maximum projections of representative images.
Above we described that in sI/R fragmented mitochondria were targets of
autophagy (Fig. 34). To investigate if autophagic removal of mitochondria was caused
RESULTS: Mitophagy VI
107
by sI/R-induced mitochondrial damage, we investigated whether Bnip3 overexpression
would likewise lead to mitophagy. To detect mitophagy we employed laser scanning
confocal microscopy of cells expressing mito-DsRed2-labeled mitochondria and GFP-
LC3-labeled autophagosomes. Analysis of generated Z-stacks revealed extensive
mitophagy in Bnip3-cotransfected HL-1 cells, where many GFP-LC3 labeled
autophagosomes co-localized with fragmented mitochondria (Fig. 40A). 3D surface
rendering of confocal Z-stacks revealed different stages of engulfment of individual
mitochondria (Fig. 40B). We did not observe instances of mitophagy in control or
Bnip3∆TM transfected cells (data not shown).
VI-5 Autophagy is a protective response against Bnip3-induced cell death
In Chapter V we showed that enhancing autophagy protects against sI/R injury. We
hypothesized that this protection was partly due to the sequestration of dysfunctional
mitochondria since mitophagy was a prominent feature of the autophagic response to sI/R
(Fig. 34). Bnip3 is involved in I/R-induced mitochondrial dysfunction (Hamacher-Brady
et al., 2006) and we found that overexpression of Bnip3 leads to mitophagy (Fig. 40).
Thus, we investigated whether autophagy protects against Bnip3-induced cell injury.
We found that overexpression of autophagy protein Beclin1 protected against
Bnip3-mediated cell death in HL-1 cells (Fig. 41A). Conversely, co-expression of
Beclin1∆Bcl2BD aggravated Bnip3-induced cell death, further indicating the importance
of physiologically regulated Beclin1. Similarly, overexpression of Atg5 significantly
reduced Bnip3-mediated cell death (Fig. 41B). In contrast, the dominant negative
Atg5K130R
increased Bnip3-mediated cell death.
Together, these results indicate that autophagy protects against Bnip3-mediated
mitochondrial dysfunction in sI/R via the selective scavenging of malfunctioning
mitochondria.
RESULTS: Mitophagy VI
108
Mito-DsRed2LC3-GFP
BNIP3
Mito-DsRed2LC3-GFP
BNIP3
(i)
(ii)
Mitochondrial sequestration
Sequesteredmitochondrion
A
B
FIG. 40. Bnip3 overexpression activates mitophagy. HL-1 cells were co-transfected with mito-DsRed2, GFP-LC3and Bnip3. 48h following transfection GFP-LC3 distribution and mito-DsRed2-labeled mitochondria were detected by 3D confocal imaging. (A) Mitochondria appeared
fragmented and were observed within autophagosomes. Scale bar, 3 µm. (B) Surface volume rendering reveals the mitophagic process in 3D showing different stages of mitochondrial engulfment in Bnip3 overexpressing cells: (i) mitochondrion undergoing sequestration (A, open arrow), and (ii) engulfed mitochondrion (A, closed arrow).
RESULTS: Mitophagy VI
109
0
10
20
30
40
50
60
Vector Beclin1 Beclin1∆Bcl2BD
Bnip
3-ind
uce
d c
ell
de
ath
(% Y
oP
ro1
-po
sitiv
e c
ells
)
*
**A
B
0
10
20
30
40
50
60
Bn
ip3
- ind
uce
d c
ell
death
(% Y
oP
ro1
- po
sitiv
e c
ells
)
Vector Atg5 Atg5K130R
70*
*
FIG. 41. Modulation of autophagy affects Bnip3-mediated cell death. (A) Cells were co-transfected with DsRed2 as a transfection marker and Bnip3 together with pcDNA3.1, Beclin1, or
Beclin1∆Bcl2BD. At 48 h after transfection, cell death of DsRed2-positive cells was assessed using YoPro1 as a vital exclusion dye (*p<0.01; **p<0.05). (B) Cells were transfected with Bnip3 and mCherry, mCherry-Atg5 or mCherry-Atg5
K130R and cell death was assessed 48 h after
transfection using YoPro1 (*p<0.05).
Chapter 7
Discussion
________________________________________________________________________
DISCUSSION
VII
113
I/R injury results in cell death of cardiac myocytes, a terminally differentiated cell type of
finite number, and consequently reduced myocardial function. Although the relative
contributions of necrosis and apoptosis (PCD type I) are still subject to much debate, both
are established as modes of cell death contributing to I/R injury (Kajstura et al., 1996).
Apoptosis is a highly-regulated genetic program that allows for intervention and thus,
rescue of cells. As such, there is much interest and need in elucidating the participants
and mechanisms involved in the regulation of cardiac myocyte apoptosis in order to
develop pharmaceutical compounds to treat heart disease.
In recent years, autophagy has come to the forefront of scientific attention, due to
the characterization of its molecular mechanism in yeast and the identification of
mammalian homologues of autophagic proteins (Klionsky and Emr, 2000). It has
emerged that autophagy is a crucial process for maintaining cell homeostasis and
disruption to the pathway can be a contributing factor to many diseases. Decreased
autophagy may be causative in the development of cancer (Yue et al., 2003) and
neurodegenerative conditions including Alzheimer’s (Nixon et al., 2005) and Parkinson’s
diseases (Webb et al., 2003; Ravikumar et al., 2004; Shibata et al., 2006). Furthermore,
excessive autophagy is recognized as a form of PCD linked to, but distinct from
apoptosis (Codogno and Meijer, 2005).
A growing number of studies report the prevalence of autophagosomes
(autophagic vesicles, AVs) in cardiac disease. However, the literature to date consists
mainly of correlative studies which infer the role of autophagy as either detrimental or
beneficial: autophagic cell death (PCD type II) has been implicated in myocardial
dysfunction (Hein et al., 2003; Akazawa et al., 2004; Saijo et al., 2004) , however, during
ischemic injury autophagy may be a protective response (Decker and Wildenthal, 1980;
Yan et al., 2005).
Thus, the main objective of this thesis was to investigate the role of autophagy in
I/R-induced activation of cell death pathways. This was accomplished by (1) the
establishment of a cardiac myocyte cell culture model allowing for the quantification of
apoptotic signaling during I/R injury, and (2) developing a sensitive method for detecting
and quantifying changes in autophagic activity. Subsequently, (3) the cause-and-effect
relationship between I/R-activated mitochondrial death signaling (apoptosis) and
DISCUSSION
VII
114
autophagy was examined. Finally, (4) based on the obtained results we investigated the
autophagic removal of mitochondria (mitophagy) as a potential mechanism of protection.
VII-1 Chapter I: HL-1 cell culture model of myocardial I/R injury allowing for
the spatio-temporal investigation of apoptosis-related signaling
pathways
Prerequisite for the investigation of apoptotic signaling in myocardial I/R was the
development and characterization of a cell culture-based model thereof. Prior to this
body of work no such model existed that closely reflected the in vivo situation:
commonly used myocyte cell lines (H9c2, C2C12) and cultured neonatal cardiac
myocytes require prolonged (from 8 to 24 h) hypoxia or simulated ischemia to activate
death signaling pathways (Dougherty et al., 2002; Hollander et al., 2003; Hou and Hsu,
2005). Alternatively, oxidizing agents (e.g. hydrogen peroxide) or initiators of apoptosis
(e.g. staurosporine) are employed as surrogates to explore I/R injury (Capano and
Crompton, 2002; Akao et al., 2003), which do not necessarily recapitulate the events of
I/R injury. We sought to establish an acute model which closely resembles the in vivo
signaling pathways during I/R injury to the heart, using the recently established cardiac
HL-1 cell line which has been described as a successful model for studying many aspects
of cardiac cell physiology (White et al., 2004). As HL-1 cells are readily transfectable,
as opposed to the adult cardiac cell which cannot be transfected using conventional
means, we consider the HL-1 cell a unique system for investigating in a single cell
resolution the pro-death and pro-survival pathways during I/R injury.
We found that HL-1 cells reproducibly underwent PCD in response to an acute (2
h) ischemic insult via pathways resembling in vivo myocardial I/R injury: we
demonstrate that in HL-1 cells sI/R leads to mitochondrial dysfunction, reflected by a
collapse of ∆Ψm and increased mitochondrial ROS production, hallmarks of the I/R
response by adult cardiac myocytes (Honda et al., 2005). In addition, sI/R injury
culminates in a redistribution of pro-apoptotic Bax and Bid, and finally cell death,
revealing a carefully orchestrated cell death program (Fig. 42).
DISCUSSION
VII
115
Of note is that our model of sI/R conferred a rather mild insult, as the cell death
program was executed over a time-course of several hours and therefore allowed us to
study a heterogeneous cell population that, like the injured myocardium in vivo,
comprised (i) cells which had suffered irreversible damage and underwent cell death and
(ii) cells which had undergone sub-lethal stress and were able to recover eventually.
VII-1.1 Mitochondrial dysfunction is an early event in sI/R injury to HL-1 cardiac myocytes
A high ∆Ψm is an excellent indicator for functional mitochondria, which are considered a
crucial parameter of cardiac cell viability (Di Lisa and Bernardi, 1998). Mitochondria
account for 30% of cardiac myocyte volume (Page et al., 1971) and supply the majority
of ATP needed for contraction and maintenance of ionic homeostasis. Apart from
disrupting cellular ATP supply, uncoupling of oxidative phosphorylation, reflected in the
loss ∆Ψm, can lead to increased leak of ROS from the electron transport chain (Vanden
Hoek et al., 1997). ROS production is a causative factor in I/R injury (Vanden Hoek et
al., 1998; Levraut et al., 2003). We found that in the first 90 min of reperfusion, sI/R-
induced mitochondrial dysfunction was apparent, reflected by loss of ∆Ψm and increased
ROS generation.
VII-1.2 Pro-apoptotic Bax activity
By combining 4D imaging of GFP-biosensors and Western blotting, we were able to
characterize the dynamics of pro-apoptotic Bcl-2 family members Bax and Bid, which
are necessary components of the machinery mediating I/R-activated PCD in the heart
(Peng et al., 2001; Hochhauser et al., 2003). GFP-based Bax fusion proteins were used
to quantify sI/R-induced Bax translocation and clustering on mitochondria in relation to
mitochondrial remodeling and depolarization at the level of the single cell.
In response to sI/R, Bax translocation occurred in two phases, a priming phase in
which Bax coated the mitochondria homogeneously, and an activation phase in which
Bax formed discrete clusters on the mitochondria. The coating phase occurred during
ischemia and early reperfusion, whereas clustering occurred hours later. Both phases
were sensitive to the p38 inhibitor SB203580, and thus are likely to be mediated by p38
activity. This is consistent with the recent report by Capano and Crompton (Capano and
DISCUSSION
VII
116
Crompton, 2002), who showed that Bax translocation and coating of mitochondria during
ischemia was dependent on p38.
Bypassing the translocation phase via expression of mCherry-BaxT182A
, which
results in spontaneous Bax translocation to mitochondria, resulted in accelerated
clustering during reperfusion. However, forced Bax translocation alone was not
sufficient to induce mitochondrial dysfunction, indicating that downstream events are
critical in the activation of PCD. Although previous studies have suggested that the loss
of ∆Ψm occurs following Bax and Bid translocation (Scorrano et al., 2002), our data
indicate that in this model, MPTP activation is upstream of Bax clustering. The loss of
∆Ψm is not necessarily indicative of MPTP activity. However, as CsA inhibited Bax
clustering, our results support the notion that sI/R-induced MPTP activation was an
upstream event for the death signal cascades (De Giorgi et al., 2002; Precht et al., 2005).
Importantly, hypoxia/reoxygenation was found to be a necessary component of sI/R, as
incubation of HL-1 cells in normoxic ischemia-mimetic solution (metabolic inhibition
without hypoxia) did not result in Bax activation.
VII-1.3 Bid activation and translocation
CFP-Bid-YFP was employed to track both the N- and C-terminal fragments of Bid. A
surprising finding was that Bid activation, via caspase 8, occurred downstream of Bax
clustering. This appears to contradict previous studies which have shown that Bax and
Bid act in concert to release pro-apoptotic proteins from the mitochondria (Eskes et al.,
2000). However, Bid may function to stimulate or amplify the cell death program by
sequestering Bcl-2/-xL, thereby facilitating the pro-apoptotic actions of Bax (Yi et al.,
2003). Another possibility for the relationship between Bid and Bax is that at sub-
detection levels tBid potentiates Bax clustering, and the second (obvious) phase of Bid
activity involves massive destruction to the mitochondria, ensuring the point of no return.
It is also possible that in this model, Bid is simply a bystander that undergoes processing
at the time of general caspase activation. Further work will be needed to establish the
role of Bid in this system.
Our findings that Bid cleavage is caspase 8-dependent in HL-1 cells is at variance
with previous studies of our lab in isolated perfused hearts which showed that Bid
cleavage was mediated by calpain (Chen et al., 2001), but is consistent with another study
DISCUSSION
VII
117
(Scarabelli et al., 2002). Calpain activation after global ischemia in the ex vivo heart has
been attributed to excessive preload (input pressure at the left atrium) (Feng et al., 2001),
which would be absent from this cell-based model.
VII-1.4 Bcl-2 and Bax activation: role of subcellular localization
Having used the GFP-based Bid and Bax biosensors to characterize the spatial and
temporal dynamics of pro-apoptotic Bcl-2 family member signaling, we subsequently
investigated the role of anti-apoptotic Bcl-2 and Bcl-xL. Both Bcl-2 and Bcl-xL, which
are potent protective proteins in myocardial I/R injury in vivo (Brocheriou et al., 2000;
Huang et al., 2005 Schneider 2004), significantly reduced mitochondrial clustering of
GFP-Bax. Bcl-2 and Bcl-xL oppose apoptotic signals from the mitochondria, through
stabilizing the mitochondrial outer membrane (Susin et al., 1996), and at the S/ER, by
decreasing pro-apoptotic Ca2+
levels (Chami et al., 2004). We found that Bcl-2 targeted
to the mitochondria strongly reduced Bax activation, whereas Bcl-2 targeted to the S/ER
did not afford protection. Thus, in sI/R injury to the HL-1 cardiac myocyte,
mitochondrial dysfunction is the major factor activating pro-death signaling.
Furthermore, these results indicate that apoptotic Ca2+
signaling may not play a dominant
role in I/R injury. In agreement with out findings, mitochondrial Ca2+
-overload was
recently shown to be a secondary event following ROS-induced MPTP opening (Kim et
al., 2006).
It is interesting to note that the physiological implications of S/ER-targeted Bcl-2
in the cardiac myocyte are unclear. Conditions which trigger S/ER-Bcl-2 translocation
have not been shown and it is not known if this is a normally occurring physiological
response. Although enforced Ca2+
release from S/ER stores, by either Bcl-2 or Bcl-xL,
minimizes the Ca2+
signaling component of apoptosis (Chami et al., 2004), it is not
known if S/ER targeted-Bcl-2 affects the ability of the cardiac myocyte to contract. It is
likely that the decrease of S/ER Ca2+
stores would be harmful to the heart by reducing its
capacity to do work.
VII-1.5 sI/R-induced mitochondrial fragmentation
Mitochondria vary in regards to their morphology. They can exist as largely
interconnected networks or as independent units (Collins et al., 2002). Interestingly, we
DISCUSSION
VII
118
found that sI/R led to the fragmentation of the previously branched and elongated HL-1
mitochondria into spherical shaped organelles. Fragmentation of mitochondrial networks
occurs in many instances of PCD (Karbowski et al., 2002; Lyamzaev et al., 2004;
Skulachev et al., 2004), and protein mediators of mitochondrial morphology have been
linked to PCD (Karbowski et al., 2002; Lee et al., 2004). For instance mitofusin2
(Mfn2), which participates in mitochondrial fusion (Santel and Fuller, 2001), has been
shown to stabilize the MPTP and block Bax translocation (Neuspiel et al., 2005), whereas
dynamin-related protein 1 (Drp1), which promotes mitochondrial fission (Smirnova et al.,
2001), has been shown to participate in Bax-mediated cytochrome c release (Frank et al.,
2001; Lee et al., 2004; Jagasia et al., 2005). Conversely, Drp1 mediated fragmentation of
mitochondrial networks has also been shown to be protective by limiting
intramitochondrial propagation of pro-apoptotic calcium signaling (Szabadkai et al.,
2004).
We found that ischemia resulted in fragmentation of the usually elongated and
branched HL-1 mitochondrial population. Unexpectedly, mitochondrial fragmentation
occurred during ischemia, before loss of ∆Ψm and Bax translocation (Fig. 42), indicating
that endogenous Drp1 activation occurs well before becoming engaged with the PCD
pathway. This differs from a report (Karbowski et al., 2002), by Youle’s group which
described Bax translocation before fragmentation in Hela and Cos-7 cells. Interestingly,
at 5 h of reperfusion, SB203580-treated cells displayed elongated mitochondria,
demonstrating that in the absence of Bax and p38 signaling, recovery of mitochondrial
filamentous morphology was possible, supporting the notion of a relationship between
Bax and the morphology machinery (Karbowski et al., 2002; Neuspiel et al., 2005)
We found that by enforcing the fragmented morphology via overexpression of
Drp1, HL-1 cells were protected from sI/R injury, as monitored by GFP-Bax clustering at
the mitochondria. Likewise, overexpression of Bcl-xL protected against sI/R injury
without preventing sI/R-induced mitochondrial fragmentation. Together, these results
indicate that in HL-1 cells mitochondrial fragmentation is a reflection of the sI/R insult
which counteracts the initiation of the apoptotic signaling cascade. We hypothesize that
the protection conferred by Drp1 is in part due to increased spacing between neighboring
mitochondria, thereby maintaining localized ATP delivery needed for contraction as well
DISCUSSION
VII
119
as ionic homeostasis, whilst limiting mitochondrion-to-mitochondrion transmission of
ROS production through ROS-induced ROS release which mediates sI/R injury (Brady et
al., 2004).
VII-1.6 Conclusions
The use of multicolor live-cell imaging enabled us to investigate the spatio-temporal
behavior of Bax and Bid during sI/R, allowing unprecedented inquiry into the
relationship between sI/R-induced pro-apoptotic signaling and mitochondrial dysfunction
pathways.
Furthermore, we conclude that the dynamics of GFP-Bax clustering at the
mitochondria are an informative parameter of irreversible apoptotic injury to the HL-1
cardiac myocyte, enabling us to investigate processes which enhance or inhibit the
tendency of a cell to undergo apoptosis.
Mito
ch
on
dria
l fr
ag
me
nta
tion
Lo
ss
of ∆Ψ
m
Ba
x tr
an
slo
ca
tio
n
Ba
x clu
ste
rin
g
Bid
activa
tio
n
Pla
sm
a m
em
bra
ne
p
erm
ea
bili
za
tio
n
Ischemia Reperfusion
CsA
SB203580
p38
TIME
Ca
sp
ase
8
FIG. 42. Time-line of events during sI/R in HL-1 cells. The scheme is an approximate representation reflecting the observed sequence of events during sI/R. Importantly, no causative relations are depicted. Bax translocation can start during ischemia, however is mostly detectable during reperfusion. Mitochondrial networks can be re-built during reperfusion in the presence of SB203580.
DISCUSSION
VII
120
VII-2 Chapter IV: Investigating autophagy in HL-1 cardiac myocytes
Autophagy is emerging as both an important process for cell physiology, as well as a
putative cytoprotective mechanism in the heart (Kuma et al., 2004; Yan et al., 2005)
(Depre et al., 2004). The characterization of a GFP-LC3 fusion protein is a driving force
in the autophagy field as it functions as a unique and specific indicator for AVs in live
cells (Kabeya et al., 2000). Currently, a demonstration of either punctate GFP-LC3-II
labeled AVs by fluorescence imaging, or LC3-II detection by Western blotting, are the
standard means for detecting changes in autophagic activity. However, it is important to
note that lysosomal degradation of LC3-II varies according to cell type (Mizushima et al.,
2004), and LC3 forms I and II are differentially recognized by the LC3 antibodies
(Kabeya et al., 2004), rendering it difficult to quantify LC3 processing via
immunodetection. Moreover, increased levels of AVs can represent impairment in the
fusion with lysosomes rather than an upregulation in autophagic activity (Trost et al.,
1998). Thus, one crucial objective of Chapter IV was to establish a technique for the
quantitative assessment of autophagy.
VII-2.1 Determination of autophagic flux
It is well known that autophagic activity is upregulated in low nutrient conditions (e.g.
amino acid and/or serum deprivation) when compared to high nutrient conditions (e.g.
fully supplemented culture medium) (Kim and Klionsky, 2000). Furthermore, the
immunosuppressant rapamycin induces autophagy even under high nutrient conditions
(Noda and Ohsumi, 1998), and the dominant negative Atg5K130R
can be used to impair
autophagy at the level of AV formation (Mizushima et al., 2001). Hence, we chose those
settings to develop and gauge a technique for the quantitative assessment of autophagy.
To quantify autophagy in our experimental system, we inhibited lysosomal degradation
and analyzed the accumulation of GFP-LC3-positive AVs during a given amount of time
by fluorescence microscopy. Our results dispute the widely held assumption that cellular
AV (LC3-II) levels correlate with autophagic activity: we show that low AV levels can
reflect either high lysosomal turnover of AVs or low autophagic activity. Cells with low
autophagic activity (full medium), high autophagic activity (nutrient deprivation), and
impaired autophagy (expressing mCherry-Atg5K130R
) all exhibit virtually identical low
steady-state levels of GFP-LC3-labeled AVs. Moreover, high AV levels can reflect either
DISCUSSION
VII
121
enhanced AV formation (rapamycin) or blocked downstream degradation of AVs
(lysosomal inhibition). Thus, the determination of steady-state AV content is not an
adequate qualitative or quantitative index of autophagy. The differences in autophagic
flux are only revealed when lysosomal trafficking is blocked. Consequently, the
difference in GFP-LC3 labeled AV content in the presence and absence of lysosomal
inhibitors is the most informative gauge of the autophagic pathway. Moreover, unlike
commonly used assays measuring degradation of long-lived proteins, the technique we
employed is specific to quantify macroautophagy. Such a distinction is relevant, as
chaperone-mediated autophagy (Paglin et al., 2005), which targets cytosolic proteins, is
strongly stimulated by ketone bodies which form during starvation (Finn and Dice, 2005)
and oxidative stress (Kiffin et al., 2004). In fact, recent findings indicate that CMA and
macroautophagy may have compensating functions (Massey et al., 2006).
VII-2.2 Regulation of Beclin1-mediated autophagy
We then sought to apply our technique for the quantification of autophagic flux to
elucidate the control over the Beclin1-mediated autophagic response exerted by its
putative interacting partner Bcl-2.
VII-2.2.1 Endogenous Bcl-2 promotes Beclin1-mediated autophagy during nutrient deprivation
The nature of the interaction between Beclin1 and Bcl-2/-xL on autophagic activity is
unclear. We found that Beclin1∆Bcl2BD reduced autophagy, indicating that Bcl-2 is a
necessary participant for maximal Beclin1-mediated autophagic activity in the HL-1
cardiac myocyte. In line with this finding, it was shown in MEFs that Bcl-2 and Bcl-xL
promote Atg5-Atg12 conjugation in response to etoposide (Shimizu et al., 2004). On the
other hand, Bcl-2 has been shown to suppress autophagy under certain conditions:
Beclin1∆Bcl2BD functioned similar to wild-type Beclin1 to promote clearance of toxic
huntingtin aggregates in neurons (Shibata et al., 2006) and Beclin1 lacking, or mutated
in, the Bcl-2 binding domain caused a massive accumulation of AVs and induced cell
death in both full medium and under starvation conditions (Pattingre et al., 2005).
Pattingre et al. further demonstrated that AV content was negatively correlated with the
amount of Bcl-2 that interacted with Beclin1, and that Bcl-2 binding of Beclin1 interferes
with the Beclin1-Vps34 interaction which signals autophagy. In support of this model
DISCUSSION
VII
122
the authors showed that high levels of Bcl-2 and Beclin1 co-immunoprecipitated under
high nutrient conditions, and, conversely Bcl-2 did not co-immunoprecipitate with
Beclin1 under low nutrient conditions (Pattingre et al., 2005). However, Zeng et al.
showed that endogenous Bcl-2 did not interact with Beclin1 in U-251 cells under full
medium conditions; only through overexpression of Bcl-2 was this interaction detected
(Zeng et al., 2006). Moreover, Kihara et al. found that under full medium conditions in
HeLa cells all of Beclin1 is bound to the class III PI 3-kinase Vps34 (Kihara et al., 2001).
These diverging reports strongly suggest that rheostatic control of autophagy by Beclin1-
Bcl-2 interaction is not a universal mechanism.
VII-2.2.2 S/ER-localized Bcl-2 depletes S/ER Ca2+-content, thereby inhibiting autophagy
High S/ER Ca2+
stores are required for autophagy (Gordon et al.). We found that S/ER-
Bcl-2 both suppressed autophagic activity similar to the previous report (Pattingre et al.,
2005) and reduced S/ER Ca2+
content, as previously shown (Dremina et al., 2004; Palmer
et al., 2004). Moreover, we directly demonstrated the Ca2+
requirement for autophagic
activity: intracellular chelation of Ca2+
by BAPTA and depletion of S/ER Ca2+
stores by
SERCA inhibitor thapsigargin both significantly suppressed autophagy. Although
overexpression of wild-type Bcl-2 slightly suppressed autophagy, this may reflect the
amount of Bcl-2 protein localized to the S/ER, which was considerably less than when
expressing S/ER-targeted Bcl-2 (results not shown). We speculate that the specialized
S/ER of the HL-1 cardiomyocyte, which contains high SERCA levels, is able to
overcome some degree of Bcl-2 leak and maintain S/ER Ca2+
-content in response to low
levels of Bcl-2 (Palmer et al., 2004), yet would be impaired by supra-physiologic levels
of Bcl-2 at the S/ER (Dremina et al., 2004). It remains unknown if S/ER Ca2+
positively
regulates autophagy, or if high cytosolic Ca2+
suppresses autophagy. One possibility is
that the C2 domain of Vps34 may respond to Ca2+
fluxes to signal the recruitment of the
autophagic machinery to the Golgi membrane (Rizo and Sudhof, 1998).
The findings that overexpression of Bcl-2 leads to S/ER Ca2+
depletion and
suppression of autophagy may be significant in our understanding of the autophagic
processes in the heart. The cardiomyocyte requires an efficient supply and delivery of
ATP from the mitochondria to perform work and maintain ionic homeostasis. Ca2+
couples mitochondrial ATP production to demand (I-3.2.3). We provided evidence that
DISCUSSION
VII
123
Ca2+
homeostasis further is coupled to the vital process of autophagy. Autophagy is
emerging as an important process involved in programmed cell death as well as
cytoprotection. We propose that the inability to mount an autophagic response due to
depleted S/ER Ca2+
is relevant for paradigms of both cellular protection and cell death.
VII-2.3 Conclusions: Chapter IV
We established a technique for the quantitative assessment of macroautophagy based on
the inhibition of lysosomal degradation of AVs. By analyzing the percentage of cells
with numerous AVs without (steady-state AVs) and with (cumulative AVs) lysosomal
inhibition, we can discriminate between (a) the percentage of cells with disrupted
autophagic flux (steady-state AVs), and (b) the percentage of cells with active autophagic
flux (cumulative AVs minus steady-state AVs). Using our novel technique to
systematically determine autophagic flux, we were able to reveal a two-tiered relationship
between autophagic activity and Bcl-2: under normal conditions Bcl-2 is a necessary
participant in autophagy via its interaction with Beclin1, yet under conditions in which
Bcl-2 is artificially concentrated at the S/ER, the consequent depletion of lumenal Ca2+
results in an overriding inhibition of autophagy.
VII-3 Chapter V: Autophagy in sI/R
In Chapter III we established a reproducible model for quantifying sI/R-activated
apoptosis. In Chapter IV we developed tools for perturbing and quantifying the
autophagic pathway with unprecedented precision. We subsequently sought to
investigate the role of autophagy during sI/R injury.
VII-3.1 Autophagic flux during sI/R
Similarly to ex vivo reports of increased AV content during myocardial I/R injury
(Decker et al., 1980; Decker and Wildenthal, 1980), we found that sI/R led to the steady-
state accumulation of AVs in HL-1 cardiac myocytes. However, as described in Chapter
IV, AV content does not correlate with autophagic activity: high steady-state AV content
can be indicative of the cell’s inability to degrade formed AVs, due to either excessive
AV formation, or a disruption of downstream degradation. Utilizing the technique we
developed for determining autophagic flux (Chapter IV), we found that the accumulation
DISCUSSION
VII
124
of GFP-LC3-labeled AVs during sI/R is complex, resulting from simultaneous alterations
in the induction and formation of AVs, their transit to and fusion with lysosomes, and
their ultimate degradation within the autophagolysosomes (Fig. 43). During ischemia,
the formation of AVs was blocked. Rapamycin treatment was unable to increase
autophagy during the ischemic period, whereas autophagic flux was robust in cells
incubated with the ischemic solution under normoxic conditions. As the conjugation
steps performed by E1-like Atg7 during the formation of the AV require ATP (Ichimura
et al., 2000), it is likely that energetic constraints of hypoxia preclude autophagy during
the ischemic period.
Reperfusion led to an increase in the formation, and, to a lesser extent,
degradation, of AVs. However, the autophagic response, i.e. the percentage of cells with
high cumulative AVs, was smaller than that seen in KH solution. Thus, it is likely that
autophagy is impaired at the level of induction. This interpretation is supported by our
finding that Atg5 overexpression did not increase autophagic activity, indicating that the
autophagic machinery downstream of Beclin1-dependent induction was functional and
not a rate-limiting factor.
The steady-state accumulation of AVs in a significant percentage of sI/R-treated
cells indicates a second disruption to the autophagic pathway downstream of AV
formation. One potential mechanism would be lysosomal dysfunction. During the onset
of some forms of PCD lysosomal proteases can be released into the cytosol where they
trigger apoptosis via cleavage of Bid and perhaps other targets (Stoka et al., 2001;
Cirman et al., 2004). Furthermore, decreased activity of the predominant lysosomal
protease cathepsin B has been reported in neuronal apoptosis (Uchiyama, 2001).
However, our experiments did not reveal a disruption of lysosomal function at the level
of the v-ATPase or cathepsin B activity indicating that autophagic flux was impaired
upstream of lysosomes. Consistent with this result, cathepsin inhibition had no effect on
sI/R-activated Bid cleavage (III-6.1). Thus, the observed accumulation of AVs during
sI/R likely reflects impaired delivery to (Webb et al., 2004), or fusion with (Gutierrez et
al., 2004) the lysosomes. Additional support for this explanation is derived from the fact
that we found little colocalization of GFP-LC3-labeled AVs and LTR-stained lysosomes
DISCUSSION
VII
125
after sI/R (data not shown). However, this technique did not allow for quantitative
analysis.
VII-3.2 Enhancing autophagic flux protects against sI/R injury
Enhanced autophagic flux (through rapamycin treatment or Beclin1 overexpression)
reduced sI/R-induced apoptosis. Conversely, pharmacologic inhibition of autophagy
with wortmannin or 3-MA, RNAi knockdown of Beclin1 and overexpression of the
dominant negative Atg5K130R
all sensitized cardiac cells to apoptosis. To the best of our
knowledge, the work presented here demonstrates for the first time that autophagy
constitutes an underlying protective response against I/R injury in heart cells.
Interestingly, protection correlated with enhanced autophagic flux. Both
rapamycin and Beclin1-overexpression increased autophagic flux by decreasing the
percentage of cells with steady-state accumulation of AVs, yet without changing the total
percentage of cells demonstrating active autophagy. In addition to their role in the
initiation of AV formation, Beclin1 and/or Vps34 have been shown to play a role in
sorting of lysosomal proteins (Kihara et al., 2001; Row et al., 2001; Obara et al., 2006).
Rab7, a member of the family of Rab GTPases which regulate transport and
tethering/docking of vesicles (Waters and Pfeffer, 1999), mediates the fusion of AVs with
lysosomes (Gutierrez et al., 2004; Jager et al., 2004). Rab7 also interacts with Beclin1
interacting partner Vps34, (Stein et al., 2003), and it has been suggested that the
localization of Rab7 to AVs is negatively regulated by mTOR (Gutierrez et al., 2004).
We propose that the protection conferred by rapamycin and Beclin1-overexpression is
linked to rescued autophagolysosome formation. Further studies will be needed to
support this hypothesis.
VII-3.3 Protection, Bcl-2, and autophagy
Cellular survival following I/R depends in large part on the interactions between anti-
apoptotic (e.g. Bcl-2, Bcl-xL) and pro-apoptotic (e.g. Bid, Bax) Bcl-2 family members.
Bcl-2 and Bcl-xL are known to protect against I/R injury (Brocheriou et al., 2000; Huang
et al., 2005), and were likewise protective in our model (III-4). We attributed the
protective effect of Bcl-2 to its action at the mitochondria. Moreover, Bcl-2 localized to
the S/ER was found to reduce autophagy due to reduced S/ER Ca2+
-content (IV-4).
DISCUSSION
VII
126
Interestingly, S/ER Bcl-2 did not reduce nor sensitize to sI/R activation of Bax, even
though S/ER Bcl-2 dramatically inhibited the autophagic response to nutrient deprivation.
It is possible that the lower levels of autophagy present during sI/R are less susceptible to
reduced S/ER Ca2+
-content. Alternatively, S/ER Bcl-2 might not further reduce S/ER
Ca2+
-content during sI/R, which is already low due to decreased decreased availability of
ATP during I/R.
Both Bcl-2 and Bcl-xL interact with Beclin1 (Liang et al., 1998). Importantly, the
ability of Atg5K130R
to block the Beclin1-mediated cytoprotection demonstrated that the
protective effect of Beclin1 is due to its enhancement of autophagy rather than a
perturbation of Bcl-2/-xL homeostasis.
Expression of Beclin1 Bcl-2 binding domain mutants has been reported to
increase AV formation and autophagic cell death (Pattingre et al., 2005). However, our
results using lysosomal inhibitors to quantify autophagic flux clearly indicate that
expression of Beclin1∆Bcl2BD decreased autophagy during both nutrient deprivation
(IV-2.4) and sI/R, and furthermore, unlike wild-type Beclin1, did not confer protection
against sI/R. Moreover, expression of either wild-type Bcl-2 or Bcl-xL had no detectable
effect on the autophagic response (data not shown), yet significantly protected against
sI/R injury. The suppressive effect of Beclin1∆Bcl2BD on autophagy indicates that an
interaction between Beclin1 and Bcl-2/-xL is required for full autophagic activity, arguing
for the possibility of coinciding pro-survival activities of both Bcl-2/-xL and autophagy.
In fact, increased expression of both Bcl-2 and Beclin1 have been correlated with
protection during myocardial stunning (Depre et al., 2004; Yan et al., 2005).
VII-3.4 Conclusions: Chapter V
We found that the accumulation of AVs in sI/R injury is indicative of impaired
autophagic flux rather than excessive autophagy. Residual levels of autophagy, although
not maximal, are part of a cellular pro-survival program as inhibition of autophagy via 3-
MA, wortmannin, and Atg5K130R
aggravated sI/R-induced apoptosis. Moreover,
enhancing autophagic flux via rapamycin or overexpression of Beclin1 protected against
sI/R-induced apoptosis. Bcl-2 supports Beclin1-mediated autophagy as a deletion of the
Beclin1 Bcl-2 binding domain decreased autophagic flux in sI/R and abolished
protection.
DISCUSSION
VII
127
Beclin 1
Class III PI3-K
3-MA,Wortmannin .
mTOR
Class I PI3-K
Rapamycin
Lysosome
Autophagolysosome
(3) (4)
(1)
(2)
AutophagosomePhagophore
PI3-P
Rab7 Bafilomycin A1
Ischemia ReperfusionAA, Serum deprivation
Bcl-2/-xL
FIG. 43. Autophagy in HL-1 cardiac myocytes. The main steps of the autophagic mechanism are (1) induction, (2) AV formation, (3) sequestration of cytoplasmic material, and (4) degradation of the AVs and cargo by lysosomal proteases (see Fig. 3, 5). Nutrient (amino acid, AA; serum) deprivation strongly activated autophagic flux. During ischemia, autophagy was inhibited at the level of autophagosome formation. Upon reperfusion, autophagy partially recovered, with submaximal induction and impaired degradation. Enhancing autophagic flux was protective against sI/R injury. Interestingly, Beclin1 enhanced autophagic flux by increasing lysosomal degradation of AVs, supporting a suggested role in lysosomal protein sorting.
VII-4 Chapter VI: Nature of protection exerted by autophagy: role of
mitophagy
In Chapter III we determined that sI/R in HL-1 cardiac myocytes leads to mitochondrial
stress, reflected by loss of ∆Ψm, increased ROS generation, and fragmentation of
mitochondria. In addition, sI/R injury culminates in Bax redistribution and cell death,
revealing the execution of the mitochondrial apoptotic pathway. In Chapter V we
determined that autophagy constitutes an underlying protective response against
mitochondrial apoptotic I/R injury in cardiac myocytes. Based on our findings we
refined our original hypothesis, and in Chapter VI sought to test whether the protection
exerted by autophagy is in part due to the degradation of malfunctioning mitochondria.
DISCUSSION
VII
128
VII-4.1 Autophagic scavenging of mitochondria (mitophagy) during sI/R
High-resolution fluorescence microscopy of mito-DsRed2-labeled mitochondria and
GFP-LC3-labeled AVs revealed autophagic sequestration of mitochondrial fragments
early in the reperfusion period. Mitophagy has been reported to occur in the in vivo
heart: Electron microscopy studies detected mitophagy in the perfused rabbit heart model
following a mild hypoxic insult (Decker et al., 1980; Decker and Wildenthal, 1980).
Destabilized mitochondria can be removed through the process of mitophagy:
mitochondria are sequestered by autophagosomes, which then deliver the mitochondria to
the lysosomes where they are degraded. Mitophagy is a normal cell function to replace
‘old’ mitochondria, and in the heart mitochondrial turnover has been clocked at 6-10 days
(Moreau et al., 2005). Tight control of the cell’s mitochondrial population is necessary, as
mitochondria are important sources of ROS (Boveris et al., 1972) due to their high
oxidative capacity consequent to meeting the extreme energetic demands of the cardiac
myocyte. Mitochondria are also ROS-excitable organelles, amplifying internal or
external ROS signals at the electron transport chain (Huser et al., 1998; Leach et al.,
2001; Brady et al., 2004), a phenomenon termed ROS-induced ROS release (Zorov et al.,
2000). As such, mitochondria are not only a target of oxidative damage but also the most
important source of oxidative stress to neighboring components of the cell, resulting in
high levels of oxidative damage to proteins, lipids and mtDNA. This ‘vicious cycle’ is
thought to contribute to I/R injury ((Juhaszova et al., 2004) and aging (Lakatta and
Sollott, 2002). Mitophagy may function during myocardial I/R injury as a means to
eliminate mitochondria which are destructive (e.g. generating ROS, releasing pro-
apoptotic molecules), thus modulating the threshold for PCD.
VII-4.2 Bnip3 and activation of the sI/R apoptotic pathway
We recently determined that Bnip3 is a major contributor to I/R injury in the ex vivo heart
via disruption of mitochondrial integrity, leading to enhanced superoxide production and
the release of pro-apoptotic factors such as cytochrome c and AIF (Hamacher-Brady et
al., 2006). In our HL-1 cardiac myocytes model, overexpression of Bnip3 was used to
mimic I/R-induced mitochondrial dysfunction in a setting in which primary causative
factors of ischemia are not in place, i.e. in nutrient and oxygen rich conditions.
DISCUSSION
VII
129
Consistent with a role in I/R-induced mitochondrial dysfunction and cell death in the ex
vivo heart, RNAi knockdown of Bnip3 decreased sI/R-mediated Bax activation.
VII-4.2.1 Bnip3, mitochondrial fragmentation, and autophagy
Similar to sI/R, Bnip3 caused extensive fragmentation of the mitochondrial network,
which correlated with an upregulation of autophagy. We identified fragmented
mitochondria inside the autophagosomes, suggesting that autophagy serves as a
protective response to remove damaged mitochondria that may be harmful to the cell. We
found that mitophagy targeted previously fragmented mitochondria and that sI/R-induced
mitochondrial fragmentation was mediated by Drp1 (III-2.1). As enforced fragmentation
prior to sI/R via overexpression of Drp1 was protective against sI/R (III-5), we
hypothesize that Drp1-mediated mitochondrial fragmentation is a prerequisite for the
scavenging of damaged mitochondria via mitophagy. A recent report by Arnoult et al. on
Drp1 and mitochondrial elimination during PCD adds new evidence to this hypothesis
(Arnoult et al., 2005).
VII-4.2.2 Autophagy protects against Bnip3 apoptotic signaling
We determined that the increase in autophagic activity was a protective response against
Bnip3-mediated cell death. Similar to the findings in sI/R, Beclin1 overexpression
protected against, while Atg5K130R
aggravated, Bnip3-induced cell death. However,
opposed to the findings in sI/R, Beclin1∆Bcl2BD massively aggravated and Atg5
overexpression protected against Bnip3-induced cell death. These data indicate that
Bnip3-induced death is counteracted by on both signaling (Beclin1) and machinery level
(Atg5) functional autophagy.
Together, these results further support the notion that mitophagy during
reperfusion is specific to sI/R signaling pathways and that autophagy is a cytoprotective
mechanism that is capable of reducing sI/R-induced damage. Furthermore, Bnip3 exerts
its toxicity by causing mitochondrial dysfunction indicating that autophagy protects
against sI/R injury by removing pro-apoptotic mitochondria.
VII-4.2.3 Signal for mitophagy?
It is not known whether Bnip3 activates the autophagic machinery directly or whether
autophagy is induced as a consequence of mitochondrial damage caused by Bnip3.
DISCUSSION
VII
130
Several studies have reported that overexpression of Bnip3 induces cell death through
MPTP opening (Vande Velde et al., 2000). Previous work has shown that the MPTP
serves as an upstream signal for mitochondrial autophagy (Elmore et al., 2001). The
MPTP has also been reported to play a role in I/R injury (Borutaite et al., 2003;
Hausenloy et al., 2003; Weiss et al., 2003), as well as in our of model of sI/R (III-3.2).
Activation of the MPTP causes collapse of ∆Ψm, the driving force for ATP synthesis,
leading us to speculate that a change in ATP:AMP may be a signaling mechanism for
autophagy. AMPK, which functions as a sensor for the intracellular energetic state, is
strongly and immediately upregulated by uncoupling of oxidative phosphorylation
(Soltoff, 2004) and can inactivate p70S6 kinase, the downstream mediator of mTOR
(Tokunaga et al., 2004). As mTOR has been reported to be localized in part to
mitochondria (Desai et al., 2002), an mTOR-AMPK interaction may govern local
selective removal of mitochondria.
VII-4.3 Conclusions
In summary, our results suggest that mitophagy is a crucial mechanism that allows the
cell to eliminate the most harmful mitochondria, thus modulating the threshold for the
onset of PCD. We propose that by removing a more susceptible subpopulation of pro-
apoptotic mitochondria responsible for local ROS generation and release of pro-apoptotic
factors the cell can prevent the recruitment of the entire mitochondrial population to the
execution of the cell death program (Lemasters et al., 1998; Skulachev, 2000).
VII-5 Perspectives: Significance in the heart
The body of work presented in this thesis demonstrates for the first time that autophagy
constitutes an underlying protective response against I/R injury in heart cells. Future
experiments are needed to determine whether autophagy, and specifically mitophagy,
represents a means to reduce cardiac I/R injury in vivo.
Clearly, establishing the mechanisms which promote the anti-apoptotic effects of
autophagy, and minimize autophagic cell death may represent a potentially powerful tool
against I/R-activated cardiac myocyte cell death. Although cell models are useful for
identifying participants and their roles in the control of autophagy over cell death, ex vivo
DISCUSSION
VII
131
and in vivo models of autophagy must be developed to determine the relevance in the
heart. PI3-K inhibitors do not discriminate between different classes of PI3-K. Long-
term administration of 3-MA toxic in heart cells (Terman et al., 2003) and furthermore,
wortmannin has been shown to inhibit class I PI3-K/Akt-dependent pro-survival
pathways in myocardial I/R injury (Tsang et al., 2004). Likewise, rapamycin, which has
been shown to be protective in neurons (Ravikumar et al., 2006), may not be acceptable
to treat the heart as it inhibits Hif-1-alpha and thus would block Hif1alpha-mediated
protective responses (Cai et al., 2003). Thus, classic means to perturb the autophagic
pathway are not ideal for studies in the heart.
TAT-mediated protein transduction which has proven useful for introducing
protective proteins to the heart, in vivo and ex vivo (Gustafsson et al., 2002; Inagaki et al.,
2003) will likely be a useful tool to dissect the role of autophagy in the heart. Our lab has
shown that proteins fused to the protein transduction domain of HIV TAT, an
amphiphatic 11 amino acid sequence can be transduced across the plasma membrane in
large quantities in the heart. TAT-fusion proteins used to introduce ARC and Bnip3∆TM
provided significant protection against I/R injury and improved cardiac function. Based
on the results of this thesis, Beclin1, Atg5 and Atg5K130R
are interesting candidates for
TAT studies.
Our method of systematically distinguishing AV content from autophagic activity,
i.e. the flux of AV formation and degradation, using lysosomal inhibition has the
potential to redefine previous reports concerning autophagy in the heart and other
models. The combination of lysosomal inhibitors and TAT-fusion proteins in the ex vivo
heart of transgenic GFP-LC3 mice (Kirisako et al., 1999; Mizushima et al., 2004) is
likely to give powerful insights into the role of autophagy in the heart.
SUMMARY
VIII
133
VIII Summary
Apoptotic cell death of cardiac myocytes contributes to cardiovascular disease. Increased
levels of autophagosomes have been reported during myocardial ischemia/reperfusion
(I/R) injury, however, whether autophagy functions as a protective or lethal response is
unclear. The overall goal of this thesis was to elucidate the nature of the relationship
between I/R-activated mitochondrial (apoptotic) death pathways and autophagy.
Apoptotic and autophagic signaling pathways were systematically perturbed to determine
cause and effect relationships. High-resolution fluorescence imaging was employed to
quantify spatial and temporal events in the single cell.
In Chapter III, we developed a cell culture-based model of simulated I/R (sI/R)
injury which closely matches the in vivo situation, using the HL-1 cardiac myocyte cell
line, specific fluorescent dyes, GFP-fusion proteins, and multidimensional fluorescence
deconvolution microscopy. During ischemia, which was simulated using a hypoxic,
glucose-free, acidic solution, mitochondrial networks fragmented. Bax translocation
from the cytosol to mitochondria was initiated during ischemia and continued during
reperfusion. However, subsequent clustering (activation) of Bax at mitochondria
occurred late into reperfusion. Enforced mitochondrial fragmentation by expression of
Drp1 reduced Bax clustering, indicating that fragmentation was a protective response.
Bid processing was caspase 8 dependent, and Bid translocation to mitochondria occurred
after Bax translocation and clustering, and shortly before cell death. Clustering of Bax
was prevented by anti-apoptotic Bcl-2 and Bcl-xL, cyclosporine A, an inhibitor of the
mitochondrial permeability transition pore, and also by SB203580, an inhibitor of p38
MAPK. Surprisingly, mitochondrial fragmentation could be reversed by the addition of
the p38 inhibitor SB203580 at reperfusion, implicating p38 MAPK in the mitochondrial
remodeling response to I/R that facilitates Bax recruitment to mitochondria.
Apoptotic and autophagic pathways are linked through the interaction of anti-
apoptotic Bcl-2 proteins with the autophagy protein Beclin1. However, the nature of the
interaction, either in promoting or blocking autophagy remains unclear. In Chapter IV
we developed a highly-sensitive, macroautophagy-specific methodology: to quantify
nutrient-deprivation-activated autophagic flux by comparing levels of GFP-LC3 labeled
autophagosomes under steady-state conditions and in the presence of lysosomal
SUMMARY
VIII
134
inhibitors. Expression of Beclin1 lacking the Bcl-2 binding domain (Beclin1∆Bcl2BD)
significantly reduced autophagic flux, indicating that Beclin1-mediated autophagy
requires an interaction with Bcl-2. In apparent contrast, overexpression of Bcl-2 slightly
suppressed autophagic flux; this effect was enhanced by targeting Bcl-2 to the
sarco/endoplasmic reticulum (S/ER). The suppressive effect on autophagy by S/ER-
targeted Bcl-2 may be in part due to the depletion of S/ER calcium stores: intracellular
scavenging of calcium by BAPTA-AM and treatment with thapsigargin, an inhibitor of
the S/ER calcium ATPase (SERCA; pumps calcium from the cytosol into the S/ER),
significantly reduced autophagic activity. These findings demonstrate that Bcl-2
regulates the autophagic response at the level of S/ER calcium content rather than via
direct interaction with Beclin1. Moreover, calcium homeostasis was identified as an
essential component of the autophagic response to nutrient deprivation.
Subsequently, in Chapter V, the dynamics and role of autophagy during sI/R were
investigated. Autophagic flux was null during the ischemic period, and increased at
reperfusion, but not to the same degree as under normoxic conditions. We found that
sI/R impaired both formation and downstream lysosomal degradation of
autophagosomes. Both rapamycin and overexpression of Beclin1 enhanced autophagic
flux following sI/R and significantly reduced activation of Bax, while 3-MA,
wortmannin, and RNAi knockdown of Beclin1 increased Bax activation. Expression of
Beclin1∆Bcl2BD resulted in decreased autophagic flux and did not protect against Bax-
activation and the expression of a dominant negative mutant of Atg5, a component of the
autophagosomal machinery downstream of Beclin1, increased Bax activation. These
results demonstrate that autophagic flux is impaired at the level of both induction and
degradation. Residual levels of autophagy, even though not maximal, functioned to
preserve cell viability following sI/R and enhancing autophagy constituted a powerful
and previously uncharacterized protective mechanism against I/R injury to the heart cell.
In Chapter VI, using high-resolution imaging we found that during sI/R
fragmented mitochondria were frequently sequestered by autophagosomes (mitophagy).
To investigate the connection between sI/R-induced mitochondrial dysfunction and
autophagy we focused on Bnip3, a mitochondrial pro-apoptotic Bcl-2 family member
which mediates I/R-induced mitochondrial dysfunction in the heart and has been shown
SUMMARY
VIII
135
to activate autophagy. RNAi knockdown identified Bnip3 as an important mediator of
sI/R injury in HL-1 cells. Overexpression of Bnip3, to simulate a specific and necessary
event in I/R-activated mitochondrial dysfunction, induced fragmentation of the
mitochondrial network and cell death in the absence of sI/R. Moreover, Bnip3
expression enhanced both steady-state levels of AVs and autophagic flux. Many of the
Bnip3-induced autophagosomes contained fragmented mitochondria. Overexpression of
both Beclin1 and Atg5 protected against Bnip3-mediated cell death, while blocking
autophagy with dominant negative mutants of Beclin1 or Atg5 enhanced cell death.
These findings indicate that the autophagic pathway opposes the mitochondrial apoptotic
pathway, in that autophagy of dysfunctional mitochondria counteracts Bnip3-mediated
mitochondrial death signaling. We hypothesize that, likewise, autophagy protects against
myocardial I/R injury via the removal of damaged mitochondria.
REFERENCES
IX
137
IX References
Abramoff, M. D. and M. A. Viergever (2002). "Computation and visualization of three-
dimensional soft tissue motion in the orbit." IEEE Trans Med Imaging 21(4): 296-304.
Acehan, D., X. Jiang, D. G. Morgan, J. E. Heuser, X. Wang and C. W. Akey (2002). "Three-
dimensional structure of the apoptosome: implications for assembly, procaspase-9
binding, and activation." Mol Cell 9(2): 423-32.
Adlam, V. J., J. C. Harrison, C. M. Porteous, A. M. James, R. A. Smith, M. P. Murphy and I. A.
Sammut (2005). "Targeting an antioxidant to mitochondria decreases cardiac ischemia-
reperfusion injury." Faseb J 19(9): 1088-95.
Akao, M., B. O'Rourke, Y. Teshima, J. Seharaseyon and E. Marban (2003). "Mechanistically
distinct steps in the mitochondrial death pathway triggered by oxidative stress in cardiac
myocytes." Circ Res 92(2): 186-94.
Akazawa, H., S. Komazaki, H. Shimomura, F. Terasaki, Y. Zou, H. Takano, T. Nagai and I.
Komuro (2004). "Diphtheria toxin-induced autophagic cardiomyocyte death plays a
pathogenic role in mouse model of heart failure." J Biol Chem 279(39): 41095-103.
Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman (1990). "Basic local
alignment search tool." J Mol Biol 215(3): 403-10.
Amarzguioui, M., J. J. Rossi and D. Kim (2005). "Approaches for chemically synthesized siRNA
and vector-mediated RNAi." FEBS Lett 579(26): 5974-81.
Ambrosio, G., J. L. Zweier, C. Duilio, P. Kuppusamy, G. Santoro, P. P. Elia, I. Tritto, P. Cirillo,
M. Condorelli, M. Chiariello and et al. (1993). "Evidence that mitochondrial respiration
is a source of potentially toxic oxygen free radicals in intact rabbit hearts subjected to
ischemia and reflow." J Biol Chem 268(25): 18532-41.
Antonsson, B. (2004). "Mitochondria and the Bcl-2 family proteins in apoptosis signaling
pathways." Mol Cell Biochem 256-257(1-2): 141-55.
Anversa, P., A. Leri and J. Kajstura (2006). "Cardiac regeneration." J Am Coll Cardiol 47(9):
1769-76.
Aplin, A., T. Jasionowski, D. L. Tuttle, S. E. Lenk and W. A. Dunn, Jr. (1992). "Cytoskeletal
elements are required for the formation and maturation of autophagic vacuoles." J Cell
Physiol 152(3): 458-66.
Arcaro, A. and M. P. Wymann (1993). "Wortmannin is a potent phosphatidylinositol 3-kinase
inhibitor: the role of phosphatidylinositol 3,4,5-trisphosphate in neutrophil responses."
Biochem J 296 ( Pt 2): 297-301.
Arnoult, D., N. Rismanchi, A. Grodet, R. G. Roberts, D. P. Seeburg, J. Estaquier, M. Sheng and
C. Blackstone (2005). "Bax/Bak-dependent release of DDP/TIMM8a promotes Drp1-
mediated mitochondrial fission and mitoptosis during programmed cell death." Curr Biol
15(23): 2112-8.
Ashkenazi, A. and V. M. Dixit (1998). "Death receptors: signaling and modulation." Science
281(5381): 1305-8.
Bagchi, D., G. J. Wetscher, M. Bagchi, P. R. Hinder, G. Perdikis, S. J. Stohs, R. A. Hinder and D.
K. Das (1997). "Interrelationship between cellular calcium homeostasis and free radical
generation in myocardial reperfusion injury." Chem Biol Interact 104(2-3): 65-85.
Baines, C. P., R. A. Kaiser, N. H. Purcell, N. S. Blair, H. Osinska, M. A. Hambleton, E. W.
Brunskill, M. R. Sayen, R. A. Gottlieb, G. W. Dorn, J. Robbins and J. D. Molkentin
(2005). "Loss of cyclophilin D reveals a critical role for mitochondrial permeability
transition in cell death." Nature 434(7033): 658-62.
Beham, A., M. C. Marin, A. Fernandez, J. Herrmann, S. Brisbay, A. M. Tari, G. Lopez-Berestein,
G. Lozano, M. Sarkiss and T. J. McDonnell (1997). "Bcl-2 inhibits p53 nuclear import
following DNA damage." Oncogene 15(23): 2767-72.
REFERENCES
IX
138
Bernardi, P., V. Petronilli, F. Di Lisa and M. Forte (2001). "A mitochondrial perspective on cell
death." Trends Biochem Sci 26(2): 112-7.
Bernardi, P., L. Scorrano, R. Colonna, V. Petronilli and F. Di Lisa (1999). "Mitochondria and cell
death. Mechanistic aspects and methodological issues." Eur J Biochem 264(3): 687-701.
Bers, D. M. (2000). "Calcium fluxes involved in control of cardiac myocyte contraction." Circ
Res 87(4): 275-81.
Blankson, H., I. Holen and P. O. Seglen (1995). "Disruption of the cytokeratin cytoskeleton and
inhibition of hepatocytic autophagy by okadaic acid." Exp Cell Res 218(2): 522-30.
Blommaart, E. F., U. Krause, J. P. Schellens, H. Vreeling-Sindelarova and A. J. Meijer (1997).
"The phosphatidylinositol 3-kinase inhibitors wortmannin and LY294002 inhibit
autophagy in isolated rat hepatocytes." Eur J Biochem 243(1-2): 240-6.
Blommaart, E. F., J. J. Luiken, P. J. Blommaart, G. M. van Woerkom and A. J. Meijer (1995).
"Phosphorylation of ribosomal protein S6 is inhibitory for autophagy in isolated rat
hepatocytes." J Biol Chem 270(5): 2320-6.
Bond, J. M., B. Herman and J. J. Lemasters (1991). "Recovery of cultured rat neonatal myocytes
from hypercontracture after chemical hypoxia." Res Commun Chem Pathol Pharmacol
71(2): 195-208.
Borutaite, V., A. Jekabsone, R. Morkuniene and G. C. Brown (2003). "Inhibition of
mitochondrial permeability transition prevents mitochondrial dysfunction, cytochrome c
release and apoptosis induced by heart ischemia." J Mol Cell Cardiol 35(4): 357-66.
Boveris, A., N. Oshino and B. Chance (1972). "The cellular production of hydrogen peroxide."
Biochem J 128(3): 617-30.
Boya, P., R. A. Gonzalez-Polo, N. Casares, J. L. Perfettini, P. Dessen, N. Larochette, D. Metivier,
D. Meley, S. Souquere, T. Yoshimori, G. Pierron, P. Codogno and G. Kroemer (2005).
"Inhibition of macroautophagy triggers apoptosis." Mol Cell Biol 25(3): 1025-40.
Brady, N. R., S. P. Elmore, J. J. van Beek, K. Krab, P. J. Courtoy, L. Hue and H. V. Westerhoff
(2004). "Coordinated behavior of mitochondria in both space and time: a reactive oxygen
species-activated wave of mitochondrial depolarization." Biophys J 87(3): 2022-34.
Breckenridge, D. G., M. Germain, J. P. Mathai, M. Nguyen and G. C. Shore (2003). "Regulation
of apoptosis by endoplasmic reticulum pathways." Oncogene 22(53): 8608-18.
Brocheriou, V., A. A. Hagege, A. Oubenaissa, M. Lambert, V. O. Mallet, M. Duriez, M. Wassef,
A. Kahn, P. Menasche and H. Gilgenkrantz (2000). "Cardiac functional improvement by
a human Bcl-2 transgene in a mouse model of ischemia/reperfusion injury." J Gene Med
2(5): 326-33.
Bruick, R. K. (2000). "Expression of the gene encoding the proapoptotic Nip3 protein is induced
by hypoxia." Proc Natl Acad Sci U S A 97(16): 9082-7.
Brunk, U. T. and A. Terman (2002). "The mitochondrial-lysosomal axis theory of aging:
accumulation of damaged mitochondria as a result of imperfect autophagocytosis." Eur J
Biochem 269(8): 1996-2002.
Brunn, G. J., J. Williams, C. Sabers, G. Wiederrecht, J. C. Lawrence, Jr. and R. T. Abraham
(1996). "Direct inhibition of the signaling functions of the mammalian target of
rapamycin by the phosphoinositide 3-kinase inhibitors, wortmannin and LY294002."
Embo J 15(19): 5256-67.
Bucci, C., P. Thomsen, P. Nicoziani, J. McCarthy and B. van Deurs (2000). "Rab7: a key to
lysosome biogenesis." Mol Biol Cell 11(2): 467-80.
Bursch, W. (2001). "The autophagosomal-lysosomal compartment in programmed cell death."
Cell Death Differ 8(6): 569-81.
Cai, Z., D. J. Manalo, G. Wei, E. R. Rodriguez, K. Fox-Talbot, H. Lu, J. L. Zweier and G. L.
Semenza (2003). "Hearts from rodents exposed to intermittent hypoxia or erythropoietin
are protected against ischemia-reperfusion injury." Circulation 108(1): 79-85.
REFERENCES
IX
139
Calvillo, L., S. Masson, M. Salio, L. Pollicino, N. De Angelis, F. Fiordaliso, A. Bai, P. Ghezzi, F.
Santangelo and R. Latini (2003). "In vivo cardioprotection by N-acetylcysteine and
isosorbide 5-mononitrate in a rat model of ischemia-reperfusion." Cardiovasc Drugs Ther
17(3): 199-208.
Canu, N., R. Tufi, A. L. Serafino, G. Amadoro, M. T. Ciotti and P. Calissano (2005). "Role of the
autophagic-lysosomal system on low potassium-induced apoptosis in cultured cerebellar
granule cells." J Neurochem 92(5): 1228-42.
Capano, M. and M. Crompton (2002). "Biphasic translocation of Bax to mitochondria." Biochem
J 367(Pt 1): 169-78.
Caro, L. H., P. J. Plomp, E. J. Wolvetang, C. Kerkhof and A. J. Meijer (1988). "3-Methyladenine,
an inhibitor of autophagy, has multiple effects on metabolism." Eur J Biochem 175(2):
325-9.
Chami, M., A. Prandini, M. Campanella, P. Pinton, G. Szabadkai, J. C. Reed and R. Rizzuto
(2004). "Bcl-2 and Bax exert opposing effects on Ca2+ signaling, which do not depend
on their putative pore-forming region." J Biol Chem 279(52): 54581-9.
Chang, L., S. H. Chiang and A. R. Saltiel (2004). "Insulin signaling and the regulation of glucose
transport." Mol Med 10(7-12): 65-71.
Chen, G., R. Ray, D. Dubik, L. Shi, J. Cizeau, R. C. Bleackley, S. Saxena, R. D. Gietz and A. H.
Greenberg (1997). "The E1B 19K/Bcl-2-binding protein Nip3 is a dimeric mitochondrial
protein that activates apoptosis." J Exp Med 186(12): 1975-83.
Chen, M., H. He, S. Zhan, S. Krajewski, J. C. Reed and R. A. Gottlieb (2001). "Bid is cleaved by
calpain to an active fragment in vitro and during myocardial ischemia/reperfusion." J Biol
Chem 276(33): 30724-8.
Chen, M., D. J. Won, S. Krajewski and R. A. Gottlieb (2002). "Calpain and mitochondria in
ischemia/reperfusion injury." J Biol Chem 277(32): 29181-6.
Cheng, E. H., M. C. Wei, S. Weiler, R. A. Flavell, T. W. Mak, T. Lindsten and S. J. Korsmeyer
(2001). "BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and
BAK-mediated mitochondrial apoptosis." Mol Cell 8(3): 705-11.
Chinnaiyan, A. M., K. O'Rourke, M. Tewari and V. M. Dixit (1995). "FADD, a novel death
domain-containing protein, interacts with the death domain of Fas and initiates
apoptosis." Cell 81(4): 505-12.
Cirman, T., K. Oresic, G. D. Mazovec, V. Turk, J. C. Reed, R. M. Myers, G. S. Salvesen and B.
Turk (2004). "Selective disruption of lysosomes in HeLa cells triggers apoptosis
mediated by cleavage of Bid by multiple papain-like lysosomal cathepsins." J Biol Chem
279(5): 3578-87.
Claycomb, W. C., N. A. Lanson, Jr., B. S. Stallworth, D. B. Egeland, J. B. Delcarpio, A. Bahinski
and N. J. Izzo, Jr. (1998). "HL-1 cells: a cardiac muscle cell line that contracts and retains
phenotypic characteristics of the adult cardiomyocyte." Proc Natl Acad Sci U S A 95(6):
2979-84.
Codogno, P. and A. J. Meijer (2005). "Autophagy and signaling: their role in cell survival and
cell death." Cell Death Differ 12 Suppl 2: 1509-18.
Collins, T. J., M. J. Berridge, P. Lipp and M. D. Bootman (2002). "Mitochondria are
morphologically and functionally heterogeneous within cells." Embo J 21(7): 1616-27.
Cory, S. and J. M. Adams (2002). "The Bcl2 family: regulators of the cellular life-or-death
switch." Nat Rev Cancer 2(9): 647-56.
CPMB Current Protocols in Molecular Biology, John Wiley & Sons.
Crompton, M. (2000). "Mitochondrial intermembrane junctional complexes and their role in cell
death." J Physiol 529 Pt 1: 11-21.
Crow, M. T., K. Mani, Y. J. Nam and R. N. Kitsis (2004). "The mitochondrial death pathway and
cardiac myocyte apoptosis." Circ Res 95(10): 957-70.
REFERENCES
IX
140
Cuervo, A. M. (2004). "Autophagy: many paths to the same end." Mol Cell Biochem 263(1-2):
55-72.
Cuervo, A. M. and J. F. Dice (1996). "A receptor for the selective uptake and degradation of
proteins by lysosomes." Science 273(5274): 501-3.
Daido, S., T. Kanzawa, A. Yamamoto, H. Takeuchi, Y. Kondo and S. Kondo (2004). "Pivotal
role of the cell death factor BNIP3 in ceramide-induced autophagic cell death in
malignant glioma cells." Cancer Res 64(12): 4286-93.
De Giorgi, F., L. Lartigue, M. K. Bauer, A. Schubert, S. Grimm, G. T. Hanson, S. J. Remington,
R. J. Youle and F. Ichas (2002). "The permeability transition pore signals apoptosis by
directing Bax translocation and multimerization." Faseb J 16(6): 607-9.
Decker, R. S., A. R. Poole, J. S. Crie, J. T. Dingle and K. Wildenthal (1980). "Lysosomal
alterations in hypoxic and reoxygenated hearts. II. Immunohistochemical and
biochemical changes in cathepsin D." Am J Pathol 98(2): 445-56.
Decker, R. S. and K. Wildenthal (1980). "Lysosomal alterations in hypoxic and reoxygenated
hearts. I. Ultrastructural and cytochemical changes." Am J Pathol 98(2): 425-44.
Degli Esposti, M. (2002). "Measuring mitochondrial reactive oxygen species." Methods 26(4):
335-40.
Depre, C., S. J. Kim, A. S. John, Y. Huang, O. E. Rimoldi, J. R. Pepper, G. D. Dreyfus, V.
Gaussin, D. J. Pennell, D. E. Vatner, P. G. Camici and S. F. Vatner (2004). "Program of
cell survival underlying human and experimental hibernating myocardium." Circ Res
95(4): 433-40.
Desagher, S. and J. C. Martinou (2000). "Mitochondria as the central control point of apoptosis."
Trends Cell Biol 10(9): 369-77.
Desai, B. N., B. R. Myers and S. L. Schreiber (2002). "FKBP12-rapamycin-associated protein
associates with mitochondria and senses osmotic stress via mitochondrial dysfunction."
Proc Natl Acad Sci U S A 99(7): 4319-24.
Di Lisa, F. and P. Bernardi (1998). "Mitochondrial function as a determinant of recovery or death
in cell response to injury." Mol Cell Biochem 184(1-2): 379-91.
Dougherty, C. J., L. A. Kubasiak, H. Prentice, P. Andreka, N. H. Bishopric and K. A. Webster
(2002). "Activation of c-Jun N-terminal kinase promotes survival of cardiac myocytes
after oxidative stress." Biochem J 362(Pt 3): 561-71.
Dremina, E. S., V. S. Sharov, K. Kumar, A. Zaidi, E. K. Michaelis and C. Schoneich (2004).
"Anti-apoptotic protein Bcl-2 interacts with and destabilizes the
sarcoplasmic/endoplasmic reticulum Ca2+-ATPase (SERCA)." Biochem J 383(Pt 2):
361-70.
Du, C., M. Fang, Y. Li, L. Li and X. Wang (2000). "Smac, a mitochondrial protein that promotes
cytochrome c-dependent caspase activation by eliminating IAP inhibition." Cell 102(1):
33-42.
Duchen, M. R. (2000). "Mitochondria and Ca(2+)in cell physiology and pathophysiology." Cell
Calcium 28(5-6): 339-48.
Dunn, W. A., Jr. (1994). "Autophagy and related mechanisms of lysosome-mediated protein
degradation." Trends Cell Biol 4(4): 139-43.
Ellsworth, D. L., P. Sholinsky, C. Jaquish, R. R. Fabsitz and T. A. Manolio (1999). "Coronary
heart disease. At the interface of molecular genetics and preventive medicine." Am J Prev
Med 16(2): 122-33.
Elmore, S. P., T. Qian, S. F. Grissom and J. J. Lemasters (2001). "The mitochondrial permeability
transition initiates autophagy in rat hepatocytes." Faseb J 15(12): 2286-7.
Elsasser, A., A. M. Vogt, H. Nef, S. Kostin, H. Mollmann, W. Skwara, C. Bode, C. Hamm and J.
Schaper (2004). "Human hibernating myocardium is jeopardized by apoptotic and
autophagic cell death." J Am Coll Cardiol 43(12): 2191-9.
REFERENCES
IX
141
Eskelinen, E. L., C. K. Schmidt, S. Neu, M. Willenborg, G. Fuertes, N. Salvador, Y. Tanaka, R.
Lullmann-Rauch, D. Hartmann, J. Heeren, K. von Figura, E. Knecht and P. Saftig (2004).
"Disturbed cholesterol traffic but normal proteolytic function in LAMP-1/LAMP-2
double-deficient fibroblasts." Mol Biol Cell 15(7): 3132-45.
Eskes, R., S. Desagher, B. Antonsson and J. C. Martinou (2000). "Bid induces the
oligomerization and insertion of Bax into the outer mitochondrial membrane." Mol Cell
Biol 20(3): 929-35.
Feng, J., B. J. Schaus, J. A. Fallavollita, T. C. Lee and J. M. Canty, Jr. (2001). "Preload induces
troponin I degradation independently of myocardial ischemia." Circulation 103(16):
2035-7.
Finn, P. F. and J. F. Dice (2005). "Ketone bodies stimulate chaperone-mediated autophagy." J
Biol Chem 280(27): 25864-70.
Foyouzi-Youssefi, R., S. Arnaudeau, C. Borner, W. L. Kelley, J. Tschopp, D. P. Lew, N.
Demaurex and K. H. Krause (2000). "Bcl-2 decreases the free Ca2+ concentration within
the endoplasmic reticulum." Proc Natl Acad Sci U S A 97(11): 5723-8.
Frank, S., B. Gaume, E. S. Bergmann-Leitner, W. W. Leitner, E. G. Robert, F. Catez, C. L. Smith
and R. J. Youle (2001). "The role of dynamin-related protein 1, a mediator of
mitochondrial fission, in apoptosis." Dev Cell 1(4): 515-25.
Frieden, M., D. James, C. Castelbou, A. Danckaert, J. C. Martinou and N. Demaurex (2004).
"Ca(2+) homeostasis during mitochondrial fragmentation and perinuclear clustering
induced by hFis1." J Biol Chem 279(21): 22704-14.
George, M. D., M. Baba, S. V. Scott, N. Mizushima, B. S. Garrison, Y. Ohsumi and D. J.
Klionsky (2000). "Apg5p functions in the sequestration step in the cytoplasm-to-vacuole
targeting and macroautophagy pathways." Mol Biol Cell 11(3): 969-82.
Ghatan, S., S. Larner, Y. Kinoshita, M. Hetman, L. Patel, Z. Xia, R. J. Youle and R. S. Morrison
(2000). "p38 MAP Kinase Mediates Bax Translocation in Nitric Oxide-induced
Apoptosis in Neurons." J. Cell Biol. 150(2): 335-348.
Gonzalez-Polo, R. A., P. Boya, A. L. Pauleau, A. Jalil, N. Larochette, S. Souquere, E. L.
Eskelinen, G. Pierron, P. Saftig and G. Kroemer (2005a). "The apoptosis/autophagy
paradox: autophagic vacuolization before apoptotic death." J Cell Sci 118(Pt 14): 3091-
102.
Gonzalez-Polo, R. A., G. Carvalho, T. Braun, D. Decaudin, C. Fabre, N. Larochette, J. L.
Perfettini, M. Djavaheri-Mergny, I. Youlyouz-Marfak, P. Codogno, M. Raphael, J.
Feuillard and G. Kroemer (2005b). "PK11195 potently sensitizes to apoptosis induction
independently from the peripheral benzodiazepin receptor." Oncogene 24(51): 7503-13.
Goping, I. S., A. Gross, J. N. Lavoie, M. Nguyen, R. Jemmerson, K. Roth, S. J. Korsmeyer and
G. C. Shore (1998). "Regulated targeting of BAX to mitochondria." J Cell Biol 143(1):
207-15.
Gordon, P. B., I. Holen, M. Fosse, J. S. Rotnes and P. O. Seglen (1993). "Dependence of
hepatocytic autophagy on intracellularly sequestered calcium." J Biol Chem 268(35):
26107-12.
Gordon, P. B., H. Hoyvik and P. O. Seglen (1992). "Prelysosomal and lysosomal connections
between autophagy and endocytosis." Biochem J 283 ( Pt 2): 361-9.
Gottlieb, R. A. (2003). "Mitochondrial signaling in apoptosis: mitochondrial daggers to the
breaking heart." Basic Res Cardiol 98(4): 242-9.
Gottlieb, R. A. and R. L. Engler (1999). "Apoptosis in myocardial ischemia-reperfusion." Ann N
Y Acad Sci 874: 412-26.
Green, D. R. and J. C. Reed (1998). "Mitochondria and apoptosis." Science 281(5381): 1309-12.
Gross, E. R., A. K. Hsu and G. J. Gross (2004). "Opioid-induced cardioprotection occurs via
glycogen synthase kinase beta inhibition during reperfusion in intact rat hearts." Circ Res
94(7): 960-6.
REFERENCES
IX
142
Guicciardi, M. E., S. F. Bronk, N. W. Werneburg, X. M. Yin and G. J. Gores (2005). "Bid is
upstream of lysosome-mediated caspase 2 activation in tumor necrosis factor alpha-
induced hepatocyte apoptosis." Gastroenterology 129(1): 269-84.
Gustafsson, A. B. and R. A. Gottlieb (2003). "Mechanisms of apoptosis in the heart." J Clin
Immunol 23(6): 447-59.
Gustafsson, A. B., M. R. Sayen, S. D. Williams, M. T. Crow and R. A. Gottlieb (2002). "TAT
protein transduction into isolated perfused hearts: TAT-apoptosis repressor with caspase
recruitment domain is cardioprotective." Circulation 106(6): 735-9.
Gutierrez, M. G., S. S. Master, S. B. Singh, G. A. Taylor, M. I. Colombo and V. Deretic (2004a).
"Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis
survival in infected macrophages." Cell 119(6): 753-66.
Gutierrez, M. G., D. B. Munafo, W. Beron and M. I. Colombo (2004b). "Rab7 is required for the
normal progression of the autophagic pathway in mammalian cells." J Cell Sci 117(Pt
13): 2687-97.
Halestrap, A. P. (2006). "Calcium, mitochondria and reperfusion injury: a pore way to die."
Biochem Soc Trans 34(Pt 2): 232-7.
Halestrap, A. P., S. J. Clarke and S. A. Javadov (2004). "Mitochondrial permeability transition
pore opening during myocardial reperfusion--a target for cardioprotection." Cardiovasc
Res 61(3): 372-85.
Hamacher-Brady, A., N. R. Brady, S. E. Logue, M. R. Sayen, M. Jinno, L. A. Kirshenbaum, R.
A. Gottlieb and A. B. Gustafsson (2006). "Response to myocardial ischemia/reperfusion
injury involves Bnip3 and autophagy." Cell Death Differ.
Hanada, M., J. Feng and B. A. Hemmings (2004). "Structure, regulation and function of
PKB/AKT--a major therapeutic target." Biochim Biophys Acta 1697(1-2): 3-16.
Hausenloy, D. J., M. R. Duchen and D. M. Yellon (2003). "Inhibiting mitochondrial permeability
transition pore opening at reperfusion protects against ischaemia-reperfusion injury."
Cardiovasc Res 60(3): 617-25.
Heibein, J. A., I. S. Goping, M. Barry, M. J. Pinkoski, G. C. Shore, D. R. Green and R. C.
Bleackley (2000). "Granzyme B-mediated Cytochrome c Release Is Regulated by the
Bcl-2 Family Members Bid and Bax." J. Exp. Med. 192(10): 1391-1402.
Hein, S., E. Arnon, S. Kostin, M. Schonburg, A. Elsasser, V. Polyakova, E. P. Bauer, W. P.
Klovekorn and J. Schaper (2003). "Progression from compensated hypertrophy to failure
in the pressure-overloaded human heart: structural deterioration and compensatory
mechanisms." Circulation 107(7): 984-91.
Higuchi, R., B. Krummel and R. K. Saiki (1988). "A general method of in vitro preparation and
specific mutagenesis of DNA fragments: study of protein and DNA interactions." Nucleic
Acids Res 16(15): 7351-67.
Hochhauser, E., S. Kivity, D. Offen, N. Maulik, H. Otani, Y. Barhum, H. Pannet, V. Shneyvays,
A. Shainberg, V. Goldshtaub, A. Tobar and B. A. Vidne (2003). "Bax ablation protects
against myocardial ischemia-reperfusion injury in transgenic mice." Am J Physiol Heart
Circ Physiol 284(6): H2351-9.
Hollander, J. M., K. M. Lin, B. T. Scott and W. H. Dillmann (2003). "Overexpression of PHGPx
and HSP60/10 protects against ischemia/reoxygenation injury." Free Radic Biol Med
35(7): 742-51.
Honda, H. M., P. Korge and J. N. Weiss (2005). "Mitochondria and ischemia/reperfusion injury."
Ann N Y Acad Sci 1047: 248-58.
Horvath, J., U. P. Ketelsen, A. Geibel-Zehender, N. Boehm, H. Olbrich, R. Korinthenberg and H.
Omran (2003). "Identification of a novel LAMP2 mutation responsible for X-
chromosomal dominant Danon disease." Neuropediatrics 34(5): 270-3.
REFERENCES
IX
143
Hou, Q. and Y.-T. Hsu (2005). "Bax translocates from cytosol to mitochondria in cardiac cells
during apoptosis: development of a GFP-Bax-stable H9c2 cell line for apoptosis
analysis." Am J Physiol Heart Circ Physiol 289(1): H477-487.
Hoyer-Hansen, M., L. Bastholm, I. S. Mathiasen, F. Elling and M. Jaattela (2005). "Vitamin D
analog EB1089 triggers dramatic lysosomal changes and Beclin 1-mediated autophagic
cell death." Cell Death Differ 12(10): 1297-309.
Hsu, H., J. Xiong and D. V. Goeddel (1995). "The TNF receptor 1-associated protein TRADD
signals cell death and NF-kappa B activation." Cell 81(4): 495-504.
Huang, J., K. Nakamura, Y. Ito, T. Uzuka, M. Morikawa, S. Hirai, K. Tomihara, T. Tanaka, Y.
Masuta, K. Ishii, K. Kato and H. Hamada (2005). "Bcl-xL gene transfer inhibits Bax
translocation and prolongs cardiac cold preservation time in rats." Circulation 112(1): 76-
83.
Huser, J., C. E. Rechenmacher and L. A. Blatter (1998). "Imaging the permeability pore transition
in single mitochondria." Biophys J 74(4): 2129-37.
Huxley, R., S. Lewington and R. Clarke (2002). "Cholesterol, coronary heart disease and stroke: a
review of published evidence from observational studies and randomized controlled
trials." Semin Vasc Med 2(3): 315-23.
Ichimura, Y., T. Kirisako, T. Takao, Y. Satomi, Y. Shimonishi, N. Ishihara, N. Mizushima, I.
Tanida, E. Kominami, M. Ohsumi, T. Noda and Y. Ohsumi (2000). "A ubiquitin-like
system mediates protein lipidation." Nature 408(6811): 488-92.
Idziorek, T., J. Estaquier, F. De Bels and J. C. Ameisen (1995). "YOPRO-1 permits
cytofluorometric analysis of programmed cell death (apoptosis) without interfering with
cell viability." J Immunol Methods 185(2): 249-58.
Imahashi, K., M. D. Schneider, C. Steenbergen and E. Murphy (2004). "Transgenic expression of
Bcl-2 modulates energy metabolism, prevents cytosolic acidification during ischemia,
and reduces ischemia/reperfusion injury." Circ Res 95(7): 734-41.
Inagaki, K., H. S. Hahn, G. W. Dorn, 2nd and D. Mochly-Rosen (2003). "Additive protection of
the ischemic heart ex vivo by combined treatment with delta-protein kinase C inhibitor
and epsilon-protein kinase C activator." Circulation 108(7): 869-75.
Ingwall, J. (2002). ATP and the Heart. Boston, Kluwer Academic Publishers.
Jagasia, R., P. Grote, B. Westermann and B. Conradt (2005). "DRP-1-mediated mitochondrial
fragmentation during EGL-1-induced cell death in C. elegans." Nature 433(7027): 754-
60.
Jager, S., C. Bucci, I. Tanida, T. Ueno, E. Kominami, P. Saftig and E.-L. Eskelinen (2004). "Role
for Rab7 in maturation of late autophagic vacuoles." J Cell Sci 117(20): 4837-4848.
Juhasz, G. and T. P. Neufeld (2006). "Autophagy: a forty-year search for a missing membrane
source." PLoS Biol 4(2): e36.
Juhaszova, M., D. B. Zorov, S. H. Kim, S. Pepe, Q. Fu, K. W. Fishbein, B. D. Ziman, S. Wang,
K. Ytrehus, C. L. Antos, E. N. Olson and S. J. Sollott (2004). "Glycogen synthase kinase-
3beta mediates convergence of protection signaling to inhibit the mitochondrial
permeability transition pore." J Clin Invest 113(11): 1535-49.
Kabeya, Y., N. Mizushima, T. Ueno, A. Yamamoto, T. Kirisako, T. Noda, E. Kominami, Y.
Ohsumi and T. Yoshimori (2000). "LC3, a mammalian homologue of yeast Apg8p, is
localized in autophagosome membranes after processing." Embo J 19(21): 5720-8.
Kabeya, Y., N. Mizushima, A. Yamamoto, S. Oshitani-Okamoto, Y. Ohsumi and T. Yoshimori
(2004). "LC3, GABARAP and GATE16 localize to autophagosomal membrane
depending on form-II formation." J Cell Sci 117(Pt 13): 2805-12.
Kajstura, J., W. Cheng, K. Reiss, W. A. Clark, E. H. Sonnenblick, S. Krajewski, J. C. Reed, G.
Olivetti and P. Anversa (1996). "Apoptotic and necrotic myocyte cell deaths are
independent contributing variables of infarct size in rats." Lab Invest 74(1): 86-107.
REFERENCES
IX
144
Kanzawa, T., L. Zhang, L. Xiao, I. M. Germano, Y. Kondo and S. Kondo (2005). "Arsenic
trioxide induces autophagic cell death in malignant glioma cells by upregulation of
mitochondrial cell death protein BNIP3." Oncogene 24(6): 980-91.
Karbowski, M., Y. J. Lee, B. Gaume, S. Y. Jeong, S. Frank, A. Nechushtan, A. Santel, M. Fuller,
C. L. Smith and R. J. Youle (2002). "Spatial and temporal association of Bax with
mitochondrial fission sites, Drp1, and Mfn2 during apoptosis." J Cell Biol 159(6): 931-8.
Karwatowska-Prokopczuk, E., J. A. Nordberg, H. L. Li, R. L. Engler and R. A. Gottlieb (1998).
"Effect of vacuolar proton ATPase on pHi, Ca2+, and apoptosis in neonatal
cardiomyocytes during metabolic inhibition/recovery." Circ Res 82(11): 1139-44.
Kelekar, A. and C. B. Thompson (1998). "Bcl-2-family proteins: the role of the BH3 domain in
apoptosis." Trends Cell Biol 8(8): 324-30.
Kiffin, R., C. Christian, E. Knecht and A. M. Cuervo (2004). "Activation of chaperone-mediated
autophagy during oxidative stress." Mol Biol Cell 15(11): 4829-40.
Kihara, A., Y. Kabeya, Y. Ohsumi and T. Yoshimori (2001a). "Beclin-phosphatidylinositol 3-
kinase complex functions at the trans-Golgi network." EMBO Rep 2(4): 330-5.
Kihara, A., T. Noda, N. Ishihara and Y. Ohsumi (2001b). "Two distinct Vps34
phosphatidylinositol 3-kinase complexes function in autophagy and carboxypeptidase Y
sorting in Saccharomyces cerevisiae." J Cell Biol 152(3): 519-30.
Kim, J. and D. J. Klionsky (2000). "Autophagy, cytoplasm-to-vacuole targeting pathway, and
pexophagy in yeast and mammalian cells." Annu Rev Biochem 69: 303-42.
Kim, J. S., L. He and J. J. Lemasters (2003). "Mitochondrial permeability transition: a common
pathway to necrosis and apoptosis." Biochem Biophys Res Commun 304(3): 463-70.
Kim, J. S., Y. Jin and J. J. Lemasters (2006). "Reactive oxygen species, but not Ca2+, triger pH-
and mitochondrial permeability transition-dependent death of adult rat myocytes after
ischemia/reperfusion " Am J Physiol Heart Circ Physiol.
Kimura, H., K. Shintani-Ishida, M. Nakajima, S. Liu, K. Matsumoto and K. Yoshida (2006).
"Ischemic preconditioning or p38 MAP kinase inhibition attenuates myocardial TNF
alpha production and mitochondria damage in brief myocardial ischemia." Life Sci
78(17): 1901-10.
Kirisako, T., M. Baba, N. Ishihara, K. Miyazawa, M. Ohsumi, T. Yoshimori, T. Noda and Y.
Ohsumi (1999). "Formation process of autophagosome is traced with Apg8/Aut7p in
yeast." J Cell Biol 147(2): 435-46.
Kirisako, T., Y. Ichimura, H. Okada, Y. Kabeya, N. Mizushima, T. Yoshimori, M. Ohsumi, T.
Takao, T. Noda and Y. Ohsumi (2000). "The reversible modification regulates the
membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to
vacuole targeting pathway." J Cell Biol 151(2): 263-76.
Klionsky, D. J. and S. D. Emr (2000). "Autophagy as a regulated pathway of cellular
degradation." Science 290(5497): 1717-21.
Knaapen, M. W., M. J. Davies, M. De Bie, A. J. Haven, W. Martinet and M. M. Kockx (2001).
"Apoptotic versus autophagic cell death in heart failure." Cardiovasc Res 51(2): 304-12.
Kochl, R., X. W. Hu, E. Y. Chan and S. A. Tooze (2006). "Microtubules facilitate
autophagosome formation and fusion of autophagosomes with endosomes." Traffic 7(2):
129-45.
Kothari, S., J. Cizeau, E. McMillan-Ward, S. J. Israels, M. Bailes, K. Ens, L. A. Kirshenbaum and
S. B. Gibson (2003). "BNIP3 plays a role in hypoxic cell death in human epithelial cells
that is inhibited by growth factors EGF and IGF." Oncogene 22(30): 4734-44.
Kouno, T., M. Mizuguchi, I. Tanida, T. Ueno, T. Kanematsu, Y. Mori, H. Shinoda, M. Hirata, E.
Kominami and K. Kawano (2005). "Solution Structure of Microtubule-associated Protein
Light Chain 3 and Identification of Its Functional Subdomains." J. Biol. Chem. 280(26):
24610-24617.
REFERENCES
IX
145
Krajewski, S., S. Tanaka, S. Takayama, M. J. Schibler, W. Fenton and J. C. Reed (1993).
"Investigation of the subcellular distribution of the bcl-2 oncoprotein: residence in the
nuclear envelope, endoplasmic reticulum, and outer mitochondrial membranes." Cancer
Res 53(19): 4701-14.
Kubasiak, L. A., O. M. Hernandez, N. H. Bishopric and K. A. Webster (2002). "Hypoxia and
acidosis activate cardiac myocyte death through the Bcl-2 family protein BNIP3." Proc
Natl Acad Sci U S A 99(20): 12825-30.
Kuma, A., M. Hatano, M. Matsui, A. Yamamoto, H. Nakaya, T. Yoshimori, Y. Ohsumi, T.
Tokuhisa and N. Mizushima (2004). "The role of autophagy during the early neonatal
starvation period." Nature 432(7020): 1032-6.
Laemmli, U. K. (1970). "Cleavage of structural proteins during the assembly of the head of
bacteriophage T4." Nature 227(5259): 680-5.
Lakatta, E. G. and S. J. Sollott (2002). "The "heartbreak" of older age." Mol Interv 2(7): 431-46.
Lamparska-Przybysz, M., B. Gajkowska and T. Motyl (2005). "Cathepsins and BID are involved
in the molecular switch between apoptosis and autophagy in breast cancer MCF-7 cells
exposed to camptothecin." J Physiol Pharmacol 56 Suppl 3: 159-79.
Leach, J. K., G. Van Tuyle, P. S. Lin, R. Schmidt-Ullrich and R. B. Mikkelsen (2001). "Ionizing
radiation-induced, mitochondria-dependent generation of reactive oxygen/nitrogen."
Cancer Res 61(10): 3894-901.
Lee, P., M. Sata, D. J. Lefer, S. M. Factor, K. Walsh and R. N. Kitsis (2003). "Fas pathway is a
critical mediator of cardiac myocyte death and MI during ischemia-reperfusion in vivo."
Am J Physiol Heart Circ Physiol 284(2): H456-63.
Lee, Y. J., S. Y. Jeong, M. Karbowski, C. L. Smith and R. J. Youle (2004). "Roles of the
mammalian mitochondrial fission and fusion mediators Fis1, Drp1, and Opa1 in
apoptosis." Mol Biol Cell 15(11): 5001-11.
Lefer, A. M., P. Tsao, N. Aoki and M. A. Palladino, Jr. (1990). "Mediation of cardioprotection by
transforming growth factor-beta." Science 249(4964): 61-4.
Lemasters, J. J. (2005). "Selective mitochondrial autophagy, or mitophagy, as a targeted defense
against oxidative stress, mitochondrial dysfunction, and aging." Rejuvenation Res 8(1):
3-5.
Lemasters, J. J., A. L. Nieminen, T. Qian, L. C. Trost, S. P. Elmore, Y. Nishimura, R. A. Crowe,
W. E. Cascio, C. A. Bradham, D. A. Brenner and B. Herman (1998). "The mitochondrial
permeability transition in cell death: a common mechanism in necrosis, apoptosis and
autophagy." Biochim Biophys Acta 1366(1-2): 177-96.
Levraut, J., H. Iwase, Z. H. Shao, T. L. Vanden Hoek and P. T. Schumacker (2003). "Cell death
during ischemia: relationship to mitochondrial depolarization and ROS generation." Am J
Physiol Heart Circ Physiol 284(2): H549-58.
Leyssens, A., A. V. Nowicky, L. Patterson, M. Crompton and M. R. Duchen (1996). "The
relationship between mitochondrial state, ATP hydrolysis, [Mg2+]i and [Ca2+]i studied
in isolated rat cardiomyocytes." J Physiol (Lond) 496(1): 111-128.
Li, H., H. Zhu, C. J. Xu and J. Yuan (1998). "Cleavage of BID by caspase 8 mediates the
mitochondrial damage in the Fas pathway of apoptosis." Cell 94(4): 491-501.
Liang, X. H., S. Jackson, M. Seaman, K. Brown, B. Kempkes, H. Hibshoosh and B. Levine
(1999). "Induction of autophagy and inhibition of tumorigenesis by beclin 1." Nature
402(6762): 672-6.
Liang, X. H., L. K. Kleeman, H. H. Jiang, G. Gordon, J. E. Goldman, G. Berry, B. Herman and B.
Levine (1998). "Protection against fatal Sindbis virus encephalitis by beclin, a novel Bcl-
2-interacting protein." J Virol 72(11): 8586-96.
Liang, X. H., J. Yu, K. Brown and B. Levine (2001). "Beclin 1 contains a leucine-rich nuclear
export signal that is required for its autophagy and tumor suppressor function." Cancer
Res 61(8): 3443-9.
REFERENCES
IX
146
Lim, M. L., M. G. Lum, T. M. Hansen, X. Roucou and P. Nagley (2002). "On the release of
cytochrome c from mitochondria during cell death signaling." J Biomed Sci 9(6 Pt 1):
488-506.
Lithgow, T., R. van Driel, J. F. Bertram and A. Strasser (1994). "The protein product of the
oncogene bcl-2 is a component of the nuclear envelope, the endoplasmic reticulum, and
the outer mitochondrial membrane." Cell Growth Differ 5(4): 411-7.
Lundberg, K. C. and L. I. Szweda (2004). "Initiation of mitochondrial-mediated apoptosis during
cardiac reperfusion." Arch Biochem Biophys 432(1): 50-7.
Lyamzaev, K. G., D. S. Izyumov, A. V. Avetisyan, F. Yang, O. Y. Pletjushkina and B. V.
Chernyak (2004). "Inhibition of mitochondrial bioenergetics: the effects on structure of
mitochondria in the cell and on apoptosis." Acta Biochim Pol 51(2): 553-62.
Maddaford, T. G., C. Hurtado, S. Sobrattee, M. P. Czubryt and G. N. Pierce (1999). "A model of
low-flow ischemia and reperfusion in single, beating adult cardiomyocytes." Am J
Physiol 277(2 Pt 2): H788-98.
Mandic, A., K. Viktorsson, L. Strandberg, T. Heiden, J. Hansson, S. Linder and M. C. Shoshan
(2002). "Calpain-mediated Bid cleavage and calpain-independent Bak modulation: two
separate pathways in cisplatin-induced apoptosis." Mol Cell Biol 22(9): 3003-13.
Marin, M. C., A. Fernandez, R. J. Bick, S. Brisbay, L. M. Buja, M. Snuggs, D. J. McConkey, A.
C. von Eschenbach, M. J. Keating and T. J. McDonnell (1996). "Apoptosis suppression
by bcl-2 is correlated with the regulation of nuclear and cytosolic Ca2+." Oncogene
12(11): 2259-66.
Marino, G., J. A. Uria, X. S. Puente, V. Quesada, J. Bordallo and C. Lopez-Otin (2003). "Human
Autophagins, a Family of Cysteine Proteinases Potentially Implicated in Cell
Degradation by Autophagy." J. Biol. Chem. 278(6): 3671-3678.
Massey, A. C., S. Kaushik, G. Sovak, R. Kiffin and A. M. Cuervo (2006). "Consequences of the
selective blockage of chaperone-mediated autophagy." Proc Natl Acad Sci U S A
103(15): 5805-10.
Miyata, S., G. Takemura, Y. Kawase, Y. Li, H. Okada, R. Maruyama, H. Ushikoshi, M. Esaki, H.
Kanamori, L. Li, Y. Misao, A. Tezuka, T. Toyo-Oka, S. Minatoguchi, T. Fujiwara and H.
Fujiwara (2006). "Autophagic cardiomyocyte death in cardiomyopathic hamsters and its
prevention by granulocyte colony-stimulating factor." Am J Pathol 168(2): 386-97.
Mizushima, N., T. Noda, T. Yoshimori, Y. Tanaka, T. Ishii, M. D. George, D. J. Klionsky, M.
Ohsumi and Y. Ohsumi (1998a). "A protein conjugation system essential for autophagy."
Nature 395(6700): 395-8.
Mizushima, N., H. Sugita, T. Yoshimori and Y. Ohsumi (1998b). "A new protein conjugation
system in human. The counterpart of the yeast Apg12p conjugation system essential for
autophagy." J Biol Chem 273(51): 33889-92.
Mizushima, N., A. Yamamoto, M. Hatano, Y. Kobayashi, Y. Kabeya, K. Suzuki, T. Tokuhisa, Y.
Ohsumi and T. Yoshimori (2001). "Dissection of autophagosome formation using Apg5-
deficient mouse embryonic stem cells." J Cell Biol 152(4): 657-68.
Mizushima, N., A. Yamamoto, M. Matsui, T. Yoshimori and Y. Ohsumi (2004). "In vivo analysis
of autophagy in response to nutrient starvation using transgenic mice expressing a
fluorescent autophagosome marker." Mol Biol Cell 15(3): 1101-11.
Moreau, R., B. T. Nguyen, C. E. Doneanu and T. M. Hagen (2005). "Reversal by aminoguanidine
of the age-related increase in glycoxidation and lipoxidation in the cardiovascular system
of Fischer 344 rats." Biochem Pharmacol 69(1): 29-40.
Mullis, K., F. Faloona, S. Scharf, R. Saiki, G. Horn and H. Erlich (1986). "Specific enzymatic
amplification of DNA in vitro: the polymerase chain reaction." Cold Spring Harb Symp
Quant Biol 51 Pt 1: 263-73.
Muzio, M., B. R. Stockwell, H. R. Stennicke, G. S. Salvesen and V. M. Dixit (1998). "An
induced proximity model for caspase-8 activation." J Biol Chem 273(5): 2926-30.
REFERENCES
IX
147
Nagai, T., K. Ibata, E. S. Park, M. Kubota, K. Mikoshiba and A. Miyawaki (2002). "A variant of
yellow fluorescent protein with fast and efficient maturation for cell-biological
applications." Nat Biotechnol 20(1): 87-90.
Narula, J., N. Haider, R. Virmani, T. G. DiSalvo, F. D. Kolodgie, R. J. Hajjar, U. Schmidt, M. J.
Semigran, G. W. Dec and B. A. Khaw (1996). "Apoptosis in myocytes in end-stage heart
failure." N Engl J Med 335(16): 1182-9.
Nechushtan, A., C. L. Smith, Y. T. Hsu and R. J. Youle (1999). "Conformation of the Bax C-
terminus regulates subcellular location and cell death." Embo J 18(9): 2330-41.
Nechushtan, A., C. L. Smith, I. Lamensdorf, S. H. Yoon and R. J. Youle (2001). "Bax and Bak
coalesce into novel mitochondria-associated clusters during apoptosis." J Cell Biol
153(6): 1265-76.
Neuspiel, M., R. Zunino, S. Gangaraju, P. Rippstein and H. McBride (2005). "Activated
mitofusin 2 signals mitochondrial fusion, interferes with Bax activation, and reduces
susceptibility to radical induced depolarization." J Biol Chem 280(26): 25060-70.
Nicholson, D. W., A. Ali, N. A. Thornberry, J. P. Vaillancourt, C. K. Ding, M. Gallant, Y.
Gareau, P. R. Griffin, M. Labelle, Y. A. Lazebnik and et al. (1995). "Identification and
inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis." Nature
376(6535): 37-43.
Nixon, R. A., J. Wegiel, A. Kumar, W. H. Yu, C. Peterhoff, A. Cataldo and A. M. Cuervo (2005).
"Extensive involvement of autophagy in Alzheimer disease: an immuno-electron
microscopy study." J Neuropathol Exp Neurol 64(2): 113-22.
Noda, T. and Y. Ohsumi (1998). "Tor, a phosphatidylinositol kinase homologue, controls
autophagy in yeast." J Biol Chem 273(7): 3963-6.
Obara, K., T. Sekito and Y. Ohsumi (2006). "Assortment of Phosphatidylinositol 3-Kinase
Complexes--Atg14p Directs Association of Complex I to the Pre-autophagosomal
Structure in Saccharomyces cerevisiae." Mol Biol Cell 17(4): 1527-39.
Oldenburg, O., M. V. Cohen, D. M. Yellon and J. M. Downey (2002). "Mitochondrial K(ATP)
channels: role in cardioprotection." Cardiovasc Res 55(3): 429-37.
Olivetti, G., R. Abbi, F. Quaini, J. Kajstura, W. Cheng, J. A. Nitahara, E. Quaini, C. Di Loreto, C.
A. Beltrami, S. Krajewski, J. C. Reed and P. Anversa (1997). "Apoptosis in the failing
human heart." N Engl J Med 336(16): 1131-41.
Oltvai, Z. N., C. L. Milliman and S. J. Korsmeyer (1993). "Bcl-2 heterodimerizes in vivo with a
conserved homolog, Bax, that accelerates programmed cell death." Cell 74(4): 609-19.
Opie, L. (1998). Heart Physiology: From Cell to Circulation.
Page, E., L. P. McCallister and B. Power (1971). "Sterological measurements of cardiac
ultrastructures implicated in excitation-contraction coupling." Proc Natl Acad Sci U S A
68(7): 1465-6.
Paglin, S., N. Y. Lee, C. Nakar, M. Fitzgerald, J. Plotkin, B. Deuel, N. Hackett, M. McMahill, E.
Sphicas, N. Lampen and J. Yahalom (2005). "Rapamycin-sensitive pathway regulates
mitochondrial membrane potential, autophagy, and survival in irradiated MCF-7 cells."
Cancer Res 65(23): 11061-70.
Palmer, A. E., C. Jin, J. C. Reed and R. Y. Tsien (2004). "Bcl-2-mediated alterations in
endoplasmic reticulum Ca2+ analyzed with an improved genetically encoded fluorescent
sensor." Proc Natl Acad Sci U S A 101(50): 17404-9.
Pattingre, S., A. Tassa, X. Qu, R. Garuti, X. H. Liang, N. Mizushima, M. Packer, M. D.
Schneider and B. Levine (2005). "Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent
autophagy." Cell 122(6): 927-39.
Peng, C.-F., P. Lee, A. Deguzman, W. Miao, M. Chandra, J. Shirani, S. Factor, D. Lefer, G.
Condorelli, A. Ardati, K. Della Penna, S. Zinkel, S. J. Korsmeyer, G. Tremp, A.
Zilberstein and R. N. Kitsis (2001). "Multiple independent mutations in apoptotic
REFERENCES
IX
148
signaling pathways markedly decrease infarct size due to myocardial ischemia-
reperfusion." Circulation (Supp)(104): II-187.
Petiot, A., E. Ogier-Denis, E. F. Blommaart, A. J. Meijer and P. Codogno (2000). "Distinct
classes of phosphatidylinositol 3'-kinases are involved in signaling pathways that control
macroautophagy in HT-29 cells." J Biol Chem 275(2): 992-8.
Poulter, N. (2003). "Global risk of cardiovascular disease." Heart 89 Suppl 2: ii2-5; discussion
ii35-7.
Precht, T. A., R. A. Phelps, D. A. Linseman, B. D. Butts, S. S. Le, T. A. Laessig, R. J. Bouchard
and K. A. Heidenreich (2005). "The permeability transition pore triggers Bax
translocation to mitochondria during neuronal apoptosis." Cell Death Differ 12(3): 255-
65.
Presley, A. D., K. M. Fuller and E. A. Arriaga (2003). "MitoTracker Green labeling of
mitochondrial proteins and their subsequent analysis by capillary electrophoresis with
laser-induced fluorescence detection." J Chromatogr B Analyt Technol Biomed Life Sci
793(1): 141-50.
Priault, M., B. Salin, J. Schaeffer, F. M. Vallette, J. P. di Rago and J. C. Martinou (2005).
"Impairing the bioenergetic status and the biogenesis of mitochondria triggers mitophagy
in yeast." Cell Death Differ.
Pyo, J. O., M. H. Jang, Y. K. Kwon, H. J. Lee, J. I. Jun, H. N. Woo, D. H. Cho, B. Choi, H. Lee,
J. H. Kim, N. Mizushima, Y. Oshumi and Y. K. Jung (2005). "Essential roles of Atg5 and
FADD in autophagic cell death: dissection of autophagic cell death into vacuole
formation and cell death." J Biol Chem 280(21): 20722-9.
Qin, Y., T. L. Vanden Hoek, K. Wojcik, T. Anderson, C. Q. Li, Z. H. Shao, L. B. Becker and K.
J. Hamann (2004). "Caspase-dependent cytochrome c release and cell death in chick
cardiomyocytes after simulated ischemia-reperfusion." Am J Physiol Heart Circ Physiol
286(6): H2280-6.
Ravikumar, B., Z. Berger, C. Vacher, J. O'Kane C and D. C. Rubinsztein (2006). "Rapamycin
pre-treatment protects against apoptosis." Hum Mol Genet 15(7): 1209-16.
Ravikumar, B., C. Vacher, Z. Berger, J. E. Davies, S. Luo, L. G. Oroz, F. Scaravilli, D. F. Easton,
R. Duden, C. J. O'Kane and D. C. Rubinsztein (2004). "Inhibition of mTOR induces
autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of
Huntington disease." Nat Genet 36(6): 585-95.
Reed, J. C., J. M. Jurgensmeier and S. Matsuyama (1998). "Bcl-2 family proteins and
mitochondria." Biochim Biophys Acta 1366(1-2): 127-37.
Regula, K. M., K. Ens and L. A. Kirshenbaum (2002). "Inducible expression of BNIP3 provokes
mitochondrial defects and hypoxia-mediated cell death of ventricular myocytes." Circ
Res 91(3): 226-31.
Rizo, J. and T. C. Sudhof (1998). "C2-domains, structure and function of a universal Ca2+-
binding domain." J Biol Chem 273(26): 15879-82.
Rizzo, M. A., G. H. Springer, B. Granada and D. W. Piston (2004). "An improved cyan
fluorescent protein variant useful for FRET." Nat Biotechnol 22(4): 445-9.
Rizzuto, R., P. Bernardi and T. Pozzan (2000). "Mitochondria as all-round players of the calcium
game." J Physiol 529 Pt 1: 37-47.
Rizzuto, R., M. Brini, P. Pizzo, M. Murgia and T. Pozzan (1995). "Chimeric green fluorescent
protein as a tool for visualizing subcellular organelles in living cells." Curr Biol 5(6):
635-42.
Rodriguez, J. and Y. Lazebnik (1999). "Caspase-9 and APAF-1 form an active holoenzyme."
Genes Dev 13(24): 3179-84.
Row, P. E., B. J. Reaves, J. Domin, J. P. Luzio and H. W. Davidson (2001). "Overexpression of a
rat kinase-deficient phosphoinositide 3-kinase, Vps34p, inhibits cathepsin D maturation."
Biochem J 353(Pt 3): 655-61.
REFERENCES
IX
149
Saeki, K., A. Yuo, E. Okuma, Y. Yazaki, S. A. Susin, G. Kroemer and F. Takaku (2000). "Bcl-2
down-regulation causes autophagy in a caspase-independent manner in human leukemic
HL60 cells." Cell Death Differ 7(12): 1263-9.
Saftig, P., Y. Tanaka, R. Lullmann-Rauch and K. von Figura (2001). "Disease model: LAMP-2
enlightens Danon disease." Trends Mol Med 7(1): 37-9.
Saijo, M., G. Takemura, M. Koda, H. Okada, S. Miyata, Y. Ohno, M. Kawasaki, K. Tsuchiya, K.
Nishigaki, S. Minatoguchi, K. Goto and H. Fujiwara (2004). "Cardiomyopathy with
prominent autophagic degeneration, accompanied by an elevated plasma brain natriuretic
peptide level despite the lack of overt heart failure." Intern Med 43(8): 700-3.
Saito, M., S. J. Korsmeyer and P. H. Schlesinger (2000). "BAX-dependent transport of
cytochrome c reconstituted in pure liposomes." Nat Cell Biol 2(8): 553-5.
Santel, A. and M. T. Fuller (2001). "Control of mitochondrial morphology by a human
mitofusin." J Cell Sci 114(Pt 5): 867-74.
Saraste, A. (1999a). "Morphologic criteria and detection of apoptosis." Herz 24(3): 189-95.
Saraste, M. (1999b). "Oxidative phosphorylation at the fin de siecle." Science 283(5407): 1488-
93.
Scarabelli, T. M., A. Stephanou, E. Pasini, L. Comini, R. Raddino, R. A. Knight and D. S.
Latchman (2002). "Different signaling pathways induce apoptosis in endothelial cells and
cardiac myocytes during ischemia/reperfusion injury." Circ Res 90(6): 745-8.
Scharf, S. J., G. T. Horn and H. A. Erlich (1986). "Direct cloning and sequence analysis of
enzymatically amplified genomic sequences." Science 233(4768): 1076-8.
Schmelzle, T. and M. N. Hall (2000). "TOR, a central controller of cell growth." Cell 103(2):
253-62.
Schmitz, I., S. Kirchhoff and P. H. Krammer (2000). "Regulation of death receptor-mediated
apoptosis pathways." Int J Biochem Cell Biol 32(11-12): 1123-36.
Schoppet, M., V. Ruppert, L. C. Hofbauer, S. Henser, N. Al-Fakhri, M. Christ, S. Pankuweit and
B. Maisch (2005). "TNF-related apoptosis-inducing ligand and its decoy receptor
osteoprotegerin in nonischemic dilated cardiomyopathy." Biochem Biophys Res
Commun 338(4): 1745-50.
Schu, P. V., K. Takegawa, M. J. Fry, J. H. Stack, M. D. Waterfield and S. D. Emr (1993).
"Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein
sorting." Science 260(5104): 88-91.
Schumann, H., H. Morawietz, K. Hakim, H. R. Zerkowski, T. Eschenhagen, J. Holtz and D.
Darmer (1997). "Alternative splicing of the primary Fas transcript generating soluble Fas
antagonists is suppressed in the failing human ventricular myocardium." Biochem
Biophys Res Commun 239(3): 794-8.
Scorrano, L., M. Ashiya, K. Buttle, S. Weiler, S. A. Oakes, C. A. Mannella and S. J. Korsmeyer
(2002). "A distinct pathway remodels mitochondrial cristae and mobilizes cytochrome c
during apoptosis." Dev Cell 2(1): 55-67.
Searle, J., J. F. Kerr and C. J. Bishop (1982). "Necrosis and apoptosis: distinct modes of cell
death with fundamentally different significance." Pathol Annu 17 Pt 2: 229-59.
Seglen, P. O. and P. Bohley (1992). "Autophagy and other vacuolar protein degradation
mechanisms." Experientia 48(2): 158-72.
Seglen, P. O. and P. B. Gordon (1982). "3-Methyladenine: specific inhibitor of
autophagic/lysosomal protein degradation in isolated rat hepatocytes." Proc Natl Acad
Sci U S A 79(6): 1889-92.
Severs, N. J. (2000). "The cardiac muscle cell." Bioessays 22(2): 188-99.
Shaner, N. C., R. E. Campbell, P. A. Steinbach, B. N. Giepmans, A. E. Palmer and R. Y. Tsien
(2004). "Improved monomeric red, orange and yellow fluorescent proteins derived from
Discosoma sp. red fluorescent protein." Nat Biotechnol 22(12): 1567-72.
REFERENCES
IX
150
Sharpe, J. C., D. Arnoult and R. J. Youle (2004). "Control of mitochondrial permeability by Bcl-2
family members." Biochim Biophys Acta 1644(2-3): 107-13.
Shi, Y. (2002). "Mechanisms of caspase activation and inhibition during apoptosis." Mol Cell
9(3): 459-70.
Shibata, M., T. Lu, T. Furuya, A. Degterev, N. Mizushima, T. Yoshimori, M. Macdonald, B.
Yankner and J. Yuan (2006). "Regulation of intracellular accumulation of mutant
Huntingtin by Beclin 1." J Biol Chem.
Shimizu, S., T. Kanaseki, N. Mizushima, T. Mizuta, S. Arakawa-Kobayashi, C. B. Thompson and
Y. Tsujimoto (2004). "Role of Bcl-2 family proteins in a non-apoptotic programmed cell
death dependent on autophagy genes." Nat Cell Biol 6(12): 1221-8.
Shimizu, S., M. Narita and Y. Tsujimoto (1999). "Bcl-2 family proteins regulate the release of
apoptogenic cytochrome c by the mitochondrial channel VDAC." Nature 399(6735): 483-
7.
Shimomura, H., F. Terasaki, T. Hayashi, Y. Kitaura, T. Isomura and H. Suma (2001).
"Autophagic degeneration as a possible mechanism of myocardial cell death in dilated
cardiomyopathy." Jpn Circ J 65(11): 965-8.
Shintani, T. and D. J. Klionsky (2004). "Autophagy in Health and Disease: A Double-Edged
Sword." Science 306(5698): 990-995.
Skulachev, V. P. (2000). "Mitochondria in the programmed death phenomena; a principle of
biology: "it is better to die than to be wrong"." IUBMB Life 49(5): 365-73.
Skulachev, V. P., L. E. Bakeeva, B. V. Chernyak, L. V. Domnina, A. A. Minin, O. Y.
Pletjushkina, V. B. Saprunova, I. V. Skulachev, V. G. Tsyplenkova, J. M. Vasiliev, L. S.
Yaguzhinsky and D. B. Zorov (2004). "Thread-grain transition of mitochondrial
reticulum as a step of mitoptosis and apoptosis." Mol Cell Biochem 256-257(1-2): 341-
58.
Smirnova, E., L. Griparic, D. L. Shurland and A. M. van der Bliek (2001). "Dynamin-related
protein Drp1 is required for mitochondrial division in mammalian cells." Mol Biol Cell
12(8): 2245-56.
Smirnova, E., D. L. Shurland, S. N. Ryazantsev and A. M. van der Bliek (1998). "A human
dynamin-related protein controls the distribution of mitochondria." J Cell Biol 143(2):
351-8.
Soltoff, S. P. (2004). "Evidence that tyrphostins AG10 and AG18 are mitochondrial uncouplers
that alter phosphorylation-dependent cell signaling." J Biol Chem 279(12): 10910-8.
Stein, M. P., Y. Feng, K. L. Cooper, A. M. Welford and A. Wandinger-Ness (2003). "Human
VPS34 and p150 are Rab7 interacting partners." Traffic 4(11): 754-71.
Stennicke, H. R. and G. S. Salvesen (2000). "Caspases - controlling intracellular signals by
protease zymogen activation." Biochim Biophys Acta 1477(1-2): 299-306.
Stoka, V., B. Turk, S. L. Schendel, T. H. Kim, T. Cirman, S. J. Snipas, L. M. Ellerby, D.
Bredesen, H. Freeze, M. Abrahamson, D. Bromme, S. Krajewski, J. C. Reed, X. M. Yin,
V. Turk and G. S. Salvesen (2001). "Lysosomal protease pathways to apoptosis.
Cleavage of bid, not pro-caspases, is the most likely route." J Biol Chem 276(5): 3149-
57.
Stypmann, J., P. M. Janssen, J. Prestle, M. A. Engelen, H. Kogler, R. Lullmann-Rauch, L.
Eckardt, K. von Figura, J. Landgrebe, A. Mleczko and P. Saftig (2006). "LAMP-2
deficient mice show depressed cardiac contractile function without significant changes in
calcium handling." Basic Res Cardiol.
Sun-Wada, G. H., Y. Wada and M. Futai (2003). "Lysosome and lysosome-related organelles
responsible for specialized functions in higher organisms, with special emphasis on
vacuolar-type proton ATPase." Cell Struct Funct 28(5): 455-63.
REFERENCES
IX
151
Susin, S. A., N. Zamzami, M. Castedo, T. Hirsch, P. Marchetti, A. Macho, E. Daugas, M.
Geuskens and G. Kroemer (1996). "Bcl-2 inhibits the mitochondrial release of an
apoptogenic protease." J Exp Med 184(4): 1331-41.
Sutton, V. R., J. E. Davis, M. Cancilla, R. W. Johnstone, A. A. Ruefli, K. Sedelies, K. A. Browne
and J. A. Trapani (2000). "Initiation of apoptosis by granzyme B requires direct cleavage
of bid, but not direct granzyme B-mediated caspase activation." J Exp Med 192(10):
1403-14.
Szabadkai, G., A. M. Simoni, M. Chami, M. R. Wieckowski, R. J. Youle and R. Rizzuto (2004).
"Drp-1-dependent division of the mitochondrial network blocks intraorganellar Ca2+
waves and protects against Ca2+-mediated apoptosis." Mol Cell 16(1): 59-68.
Tanida, I., N. Minematsu-Ikeguchi, T. Ueno and E. Kominami (2005). "Lysosomal Turnover, but
Not a Cellular Level, of Endogenous LC3 is a Marker for Autophagy." Autophagy 1(2):
084-091.
Tanida, I., T. Ueno and E. Kominami (2004). "LC3 conjugation system in mammalian
autophagy." Int J Biochem Cell Biol 36(12): 2503-18.
Tartaglia, L. A. and D. V. Goeddel (1992). "Two TNF receptors." Immunol Today 13(5): 151-3.
Terman, A., H. Dalen, J. W. Eaton, J. Neuzil and U. T. Brunk (2003). "Mitochondrial recycling
and aging of cardiac myocytes: the role of autophagocytosis." Exp Gerontol 38(8): 863-
76.
Tewari, M., L. T. Quan, K. O'Rourke, S. Desnoyers, Z. Zeng, D. R. Beidler, G. G. Poirier, G. S.
Salvesen and V. M. Dixit (1995). "Yama/CPP32 beta, a mammalian homolog of CED-3,
is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose)
polymerase." Cell 81(5): 801-9.
Thastrup, O., P. J. Cullen, B. K. Drobak, M. R. Hanley and A. P. Dawson (1990). "Thapsigargin,
a tumor promoter, discharges intracellular Ca2+ stores by specific inhibition of the
endoplasmic reticulum Ca2(+)-ATPase." Proc Natl Acad Sci U S A 87(7): 2466-70.
Thom, T., N. Haase, W. Rosamond, V. J. Howard, J. Rumsfeld, T. Manolio, Z. J. Zheng, K.
Flegal, C. O'Donnell, S. Kittner, D. Lloyd-Jones, D. C. Goff, Jr., Y. Hong, R. Adams, G.
Friday, K. Furie, P. Gorelick, B. Kissela, J. Marler, J. Meigs, V. Roger, S. Sidney, P.
Sorlie, J. Steinberger, S. Wasserthiel-Smoller, M. Wilson and P. Wolf (2006). "Heart
disease and stroke statistics--2006 update: a report from the American Heart Association
Statistics Committee and Stroke Statistics Subcommittee." Circulation 113(6): e85-151.
Thornberry, N. A. and Y. Lazebnik (1998). "Caspases: enemies within." Science 281(5381):
1312-6.
Tokunaga, C., K. Yoshino and K. Yonezawa (2004). "mTOR integrates amino acid- and energy-
sensing pathways." Biochem Biophys Res Commun 313(2): 443-6.
Trost, S. U., J. H. Omens, W. J. Karlon, M. Meyer, R. Mestril, J. W. Covell and W. H. Dillmann
(1998). "Protection Against Myocardial Dysfunction After a Brief Ischemic Period in
Transgenic Mice Expressing Inducible Heat Shock Protein 70 " J. Clin. Invest. 101(4):
855-862.
Tsang, A., D. J. Hausenloy, M. M. Mocanu and D. M. Yellon (2004). "Postconditioning: a form
of "modified reperfusion" protects the myocardium by activating the phosphatidylinositol
3-kinase-Akt pathway." Circ Res 95(3): 230-2.
Tsien, R. Y. (1980). "New calcium indicators and buffers with high selectivity against
magnesium and protons: design, synthesis, and properties of prototype structures."
Biochemistry 19(11): 2396-404.
Turrens, J. F., A. Alexandre and A. L. Lehninger (1985). "Ubisemiquinone is the electron donor
for superoxide formation by complex III of heart mitochondria." Arch Biochem Biophys
237(2): 408-14.
Turrens, J. F. and A. Boveris (1980). "Generation of superoxide anion by the NADH
dehydrogenase of bovine heart mitochondria." Biochem J 191(2): 421-7.
REFERENCES
IX
152
Uchiyama, Y. (2001). "Autophagic cell death and its execution by lysosomal cathepsins." Arch
Histol Cytol 64(3): 233-46.
Vande Velde, C., J. Cizeau, D. Dubik, J. Alimonti, T. Brown, S. Israels, R. Hakem and A. H.
Greenberg (2000). "BNIP3 and genetic control of necrosis-like cell death through the
mitochondrial permeability transition pore." Mol Cell Biol 20(15): 5454-68.
Vanden Hoek, T. L., L. B. Becker, Z. Shao, C. Li and P. T. Schumacker (1998). "Reactive
oxygen species released from mitochondria during brief hypoxia induce preconditioning
in cardiomyocytes." J Biol Chem 273(29): 18092-8.
Vanden Hoek, T. L., Z. Shao, C. Li, P. T. Schumacker and L. B. Becker (1997). "Mitochondrial
electron transport can become a significant source of oxidative injury in
cardiomyocytes." J Mol Cell Cardiol 29(9): 2441-50.
Verhagen, A. M., P. G. Ekert, M. Pakusch, J. Silke, L. M. Connolly, G. E. Reid, R. L. Moritz, R.
J. Simpson and D. L. Vaux (2000). "Identification of DIABLO, a mammalian protein that
promotes apoptosis by binding to and antagonizing IAP proteins." Cell 102(1): 43-53.
Vieira, O. V., R. J. Botelho, L. Rameh, S. M. Brachmann, T. Matsuo, H. W. Davidson, A.
Schreiber, J. M. Backer, L. C. Cantley and S. Grinstein (2001). "Distinct roles of class I
and class III phosphatidylinositol 3-kinases in phagosome formation and maturation." J
Cell Biol 155(1): 19-25.
Wang, K., X. M. Yin, D. T. Chao, C. L. Milliman and S. J. Korsmeyer (1996). "BID: a novel
BH3 domain-only death agonist." Genes Dev 10(22): 2859-69.
Waters, M. G. and S. R. Pfeffer (1999). "Membrane tethering in intracellular transport." Curr
Opin Cell Biol 11(4): 453-9.
Webb, J. L., B. Ravikumar, J. Atkins, J. N. Skepper and D. C. Rubinsztein (2003). "Alpha-
Synuclein is degraded by both autophagy and the proteasome." J Biol Chem 278(27):
25009-13.
Webb, J. L., B. Ravikumar and D. C. Rubinsztein (2004). "Microtubule disruption inhibits
autophagosome-lysosome fusion: implications for studying the roles of aggresomes in
polyglutamine diseases." Int J Biochem Cell Biol 36(12): 2541-50.
Wei, M. C., T. Lindsten, V. K. Mootha, S. Weiler, A. Gross, M. Ashiya, C. B. Thompson and S.
J. Korsmeyer (2000). "tBID, a membrane-targeted death ligand, oligomerizes BAK to
release cytochrome c." Genes Dev 14(16): 2060-71.
Weiner, M. P., T. Gackstetter, G. L. Costa, J. C. Bauer and K. A. Kretz (1995). Site-directed
Mutagenesis using PCR. Wymondham, Horizon Scientific Press.
Weiss, J. N., P. Korge, H. M. Honda and P. Ping (2003). "Role of the Mitochondrial Permeability
Transition in Myocardial Disease." Circ Res 93(4): 292-301.
Werneburg, N., M. E. Guicciardi, X. M. Yin and G. J. Gores (2004). "TNF-alpha-mediated
lysosomal permeabilization is FAN and caspase 8/Bid dependent." Am J Physiol
Gastrointest Liver Physiol 287(2): G436-43.
White, S. M., P. E. Constantin and W. C. Claycomb (2004). "Cardiac physiology at the cellular
level: use of cultured HL-1 cardiomyocytes for studies of cardiac muscle cell structure
and function." Am J Physiol Heart Circ Physiol 286(3): H823-829.
Winchester, B. G. (2001). "Lysosomal membrane proteins." Eur J Paediatr Neurol 5 Suppl A: 11-
9.
Wolter, K. G., Y. T. Hsu, C. L. Smith, A. Nechushtan, X. G. Xi and R. J. Youle (1997).
"Movement of Bax from the cytosol to mitochondria during apoptosis." J Cell Biol
139(5): 1281-92.
Xu, C., B. Bailly-Maitre and J. C. Reed (2005). "Endoplasmic reticulum stress: cell life and death
decisions." J Clin Invest 115(10): 2656-64.
Xue, L., G. C. Fletcher and A. M. Tolkovsky (1999). "Autophagy is activated by apoptotic
signalling in sympathetic neurons: an alternative mechanism of death execution." Mol
Cell Neurosci 14(3): 180-98.
REFERENCES
IX
153
Xue, L., G. C. Fletcher and A. M. Tolkovsky (2001). "Mitochondria are selectively eliminated
from eukaryotic cells after blockade of caspases during apoptosis." Curr Biol 11(5): 361-
5.
Yamaguchi, S., M. Yamaoka, M. Okuyama, J. Nitoube, A. Fukui, M. Shirakabe, K. Shirakawa,
N. Nakamura and H. Tomoike (1999). "Elevated circulating levels and cardiac secretion
of soluble Fas ligand in patients with congestive heart failure." Am J Cardiol 83(10):
1500-3, A8.
Yamamoto, A., Y. Tagawa, T. Yoshimori, Y. Moriyama, R. Masaki and Y. Tashiro (1998).
"Bafilomycin A1 prevents maturation of autophagic vacuoles by inhibiting fusion
between autophagosomes and lysosomes in rat hepatoma cell line, H-4-II-E cells." Cell
Struct Funct 23(1): 33-42.
Yan, L., D. E. Vatner, S. J. Kim, H. Ge, M. Masurekar, W. H. Massover, G. Yang, Y. Matsui, J.
Sadoshima and S. F. Vatner (2005). "Autophagy in chronically ischemic myocardium."
Proc Natl Acad Sci U S A 102(39): 13807-12.
Yanagisawa, H., T. Miyashita, Y. Nakano and D. Yamamoto (2003). "HSpin1, a transmembrane
protein interacting with Bcl-2/Bcl-xL, induces a caspase-independent autophagic cell
death." Cell Death Differ 10(7): 798-807.
Yasuda, M., P. Theodorakis, T. Subramanian and G. Chinnadurai (1998). "Adenovirus E1B-
19K/BCL-2 interacting protein BNIP3 contains a BH3 domain and a mitochondrial
targeting sequence." J Biol Chem 273(20): 12415-21.
Yi, X., X. M. Yin and Z. Dong (2003). "Inhibition of Bid-induced apoptosis by Bcl-2. tBid
insertion, Bax translocation, and Bax/Bak oligomerization suppressed." J Biol Chem
278(19): 16992-9.
Yoshimori, T., A. Yamamoto, Y. Moriyama, M. Futai and Y. Tashiro (1991). "Bafilomycin A1, a
specific inhibitor of vacuolar-type H(+)-ATPase, inhibits acidification and protein
degradation in lysosomes of cultured cells." J Biol Chem 266(26): 17707-12.
Yu, L., A. Alva, H. Su, P. Dutt, E. Freundt, S. Welsh, E. H. Baehrecke and M. J. Lenardo (2004).
"Regulation of an ATG7-beclin 1 program of autophagic cell death by caspase-8."
Science 304(5676): 1500-2.
Yuan, H., S. D. Williams, S. Adachi, T. Oltersdorf and R. A. Gottlieb (2003). "Cytochrome c
dissociation and release from mitochondria by truncated Bid and ceramide."
Mitochondrion 2(4): 237-44.
Yue, Z., S. Jin, C. Yang, A. J. Levine and N. Heintz (2003). "Beclin 1, an autophagy gene
essential for early embryonic development, is a haploinsufficient tumor suppressor."
PNAS 100(25): 15077-15082.
Zeng, X., J. H. Overmeyer and W. A. Maltese (2006). "Functional specificity of the mammalian
Beclin-Vps34 PI 3-kinase complex in macroautophagy versus endocytosis and lysosomal
enzyme trafficking." J Cell Sci 119(Pt 2): 259-70.
Zerial, M. and H. McBride (2001). "Rab proteins as membrane organizers." Nat Rev Mol Cell
Biol 2(2): 107-17.
Zha, J., S. Weiler, K. J. Oh, M. C. Wei and S. J. Korsmeyer (2000). "Posttranslational N-
myristoylation of BID as a molecular switch for targeting mitochondria and apoptosis."
Science 290(5497): 1761-5.
Zhu, H. L., A. S. Stewart, M. D. Taylor, C. Vijayasarathy, T. J. Gardner and H. L. Sweeney
(2000). "Blocking free radical production via adenoviral gene transfer decreases cardiac
ischemia-reperfusion injury." Mol Ther 2(5): 470-5.
Zorov, D. B., C. R. Filburn, L. O. Klotz, J. L. Zweier and S. J. Sollott (2000). "Reactive oxygen
species (ROS)-induced ROS release: a new phenomenon accompanying induction of the
mitochondrial permeability transition in cardiac myocytes." J Exp Med 192(7): 1001-14.
Zweier, J. L., J. T. Flaherty and M. L. Weisfeldt (1987). Proc Natl Acad Sci U S A 84(5): 1404-7.
APPENDIX
X
155
X Appendix
X-1 Figure index
FIG. 1. Comprehensive schema of signaling pathways implicated in apoptosis (PCD type
I) of cardiac myocytes. 9
FIG. 2. Bcl-2 homology domains. 13
FIG. 3. Macroautophagy is a three-step process. 16
FIG. 4. Two ubiquitin-like conjugation systems during autophagosome formation. 18
FIG. 5. Molecular mechanism and regulation of autophagy. 21
FIG. 6. sI/R in HL-1 cardiac myocytes leads to mitochondrial dysfunction. 46
FIG. 7. sI/R causes the disruption of the mitochondrial network. 47
FIG. 8. Drp1 mediates the disruption of the mitochondrial network. 49
FIG. 9. sI/R-induced Bax translocation to mitochondria. 50
FIG. 10. Bax translocation to mitochondria independent of mitochondrial dysfunction.52
FIG. 11. MPTP is upstream of GFP-Bax activation. 53
FIG. 12. sI/R-specific GFP-Bax clustering. 54
FIG. 13. Anti-apoptotic Bcl-2 and Bcl-xL oppose sI/R-induced GFP-Bax clustering. 55
FIG. 14. Fissioned mitochondria afford protection from sI/R injury in HL-1 cells and Bcl-
xL protects independently of mitochondrial fission. 56
FIG. 15. YFP-Bid-CFP sensor to monitor Bid activation. 58
FIG. 16. Bid cleavage during sI/R is mediated by caspase 8. 59
FIG. 17. Sequential activation of Bax and Bid in response to sI/R. 60
FIG. 18. Inhibition of lysosomal activity with the inhibitor cocktail. 66
FIG. 19. Basal and rapamycin-activated autophagic activity in full medium. 68
FIG. 20. Autophagic flux under nutrient deprivation. 69
FIG. 21. Atg5 control of autophagosome formation. 71
FIG. 22. Beclin1 regulation of the autophagic response. 74
FIG. 23. Bcl-2 control of autophagic activity. 75
FIG. 24. Bcl-2 reduces S/ER Ca2+
content. 76
FIG. 25. Role of S/ER Ca2+
stores on nutrient deprivation induced autophagy. 77
FIG. 26. Analysis of cellular autophagosomal content during sI/R. 82
FIG. 27. Flux of LC3-II degradation during sI/R. 84
FIG. 28. Assessment of lysosomal activity and participation in pro-death signaling. 85
FIG. 29. Pharmacologic interference with autophagy induction. 88
FIG. 30. Effect of pharmacological interference upstream of AV formation on sI/R
injury. 89
FIG. 31. Beclin 1 overexpression protects against sI/R injury. 90
FIG. 32. Beclin1-mediated protection in sI/R correlates with its effect on autophagy. 93
FIG. 33. Inhibition of Atg5 increases sI/R injury and abolishes protection through
Beclin1 95
APPENDIX
X
156
FIG. 34. sI/R leads to autophagic sequestration of fragmented mitochondria. 101
FIG. 35. Bnip3 mediates sI/R injury in the HL-1 cardiac myocyte. 103
FIG. 36. Bnip3 overexpression activates cell death in HL-1 cardiac myocytes. 103
FIG. 37. Bnip3 overexpression increases autophagic flux in full medium. 105
FIG. 38. Fusion between AVs and lysosomes seems functional in Bnip3-overexpressing
cells. 106
FIG. 39. Bnip3 overexpression results in fragmentation of the mitochondrial network.106
FIG. 40. Bnip3 overexpression activates mitophagy. 108
FIG. 41. Modulation of autophagy affects Bnip3-mediated cell death. 109
FIG. 42. Time-line of events during sI/R in HL-1 cells 119
FIG. 43. Autophagy in HL-1 cardiac myocytes 127
X-2 Oligonucleotides
Construct Oligo Comment Sequence1
pmCherry-
C1
Forw. AgeI GTAACCGGTATGGTGAGCAAGGGCGAG
Rev. BglII GTAAGATCTCTTG TACAGCTCGTCCATGC
mCherry-
Bax(WT)
Forw. BglII GTAAGATCTATGGACGGGTCCGGGGAG
Rev. EcoRI GTAGAATTCTCAGCCCACT TCTTCCAGATGGTG
mCherry-
BaxT182A
Forw. T182A GGGAGTGCTCGCCGCCTCACTCACCATCTGG
Rev. CCAGATGGTGAGTGAGGCGGCGAGCACTCCC
YFP-Bid-
CFP
Forw. YFP(AgeI) GTAACCGGTATGGTGAGCAAGGGCGAGG
Rev. YFP(XhoI) GTACTCGAGCTTGTACAGCTCGTCCATGC
Forw. Bid(XhoI) GTACTCGAGATGGACTGTGAGGTCAACAACG
Rev. Bid(SphI) GTAGCATGCGTCCATCCCATTTCTGGC
Forw. CFP(SphI) GTAGCATGCATGGTGAGCAAGGGCGAGG
Rev. CFP(NotI) GCAGCGGCCGCTTACTTGTACAGCTCGTCC
Bid∆casp8 Forw. D60E GAGCTGCAGACTGAGGGCAACCGCAGCAGC
Rev. GCTGCTGCGGTTGCCCTCAGTCTGCAGCTC
Atg5 Forw. XhoI GTACTCGAGGGATGACAGATGACAAAGATGTG
Rev. BamHI GTAGGATCCATCTGTTGGCTGGGGGAC
Atg5K130R
Forw. K130R GTCGTGTATGAGAGAAGCTGATG
Rev. CATCAGCTTCTCTCATACACGAC
Bnip3
miRNA
‘78’ Target TCCAGCCTCCGTCTCTATTTA
Complement TAAATAGAGACGGAGGCTGGA
Beclin1 ‘a’ Target TGAAACTTCAGACCCATCTTA
miRNA Complement TAAGATGGGTCTGAAGTTTCA
‘b’ Target TAATGGAGCTGTGAGTTCCTG
Complement CAGGAACTCACAGCTCCATTA 1Sequences are shown 5-prime to 3-prime with restriction sites underlined. Oligo,
oligonucleotide; Forw., forward; Rev., reverse
APPENDIX
X
157
X-3 Amino acid code
Single letter code Abbreviation Amino acid
G Gly Glycine
P Pro Proline
A Ala Alanine
V Val Valine
L Leu Leucine
I Ile Isoleucine
M Met Methionine
C Cys Cysteine
F Phe Phenylalanine
Y Tyr Tyrosine
W Trp Tryptophan
H His Histidine
K Lys Lysine
R Arg Arginine
Q Gln Glutamine
N Asn Asparagine
E Glu Glutamic acid
D Asp Aspartic acid
S Ser Serine
T Thr Threonine
APPENDIX
X
158
X-4 Fluorescent dyes
Fluorescent dye2
Abbreviation Excitation/Emission
Maxima (nm)
Concentration Phenomenon/
specificity
Carboxymethyl-
dihydrochlorofluorescein
diacetate
CM-H2DCF-
DA 500 /530 10 µM ROS
Fluo-4 Fluo-4 491 /518 2 µM Ca2+
LysoTracker Red
LTR 577 /590 50 nM Acidic vesicles
(z-RR)2-MagicRed-
Cathepsin B substrate MagicRed 550 /610 10 nM Cathepsin B
Rhodamine 123 Rhod123 485 /530 50 nM ∆Ψm
Tetramethylrhodamine
methyl ester TMRM 556 /576 100 nM ∆Ψm
Yo-Pro-1 iodide YoPro1 491 /509 100 nM Plasmamembrane
integrity 2Listed are the fluorescent dyes used in this thesis.
X-5 Fluorescent protein variants
Fluorescent protein
variant3
Abbreviation Excitation/
Emission
Maxima (nm)
Comments Originator
Green fluorescent protein GFP 488 /509 variant ‘EGFP’ Clontech
Cyan fluorescent protein CFP 433 (452) /475
(505) variant ‘ECFP’ Clontech
ECFPS72A/Y145A/H148D
Cerulean 433 /475 brighter, >lifetime Dr. D. Piston
DsRed2 DsRed2 558 /583 forms dimers Clontech
mCherry mCherry 587 /610 monomeric Dr. R. Tsien
Yellow fluorescent protein YFP 516/ 529 variant ‘EYFP’ Clontech
EYFP F64L/M153T/V163A/S175G
Venus 515 /528 pH & Cl- insensitive Dr. A. Miyawaki
3Listed are the fluorescent protein variants used in this thesis. ‘E’ in ‘EGFP’, ‘ECFP’, and ‘EYFP’:
enhanced.
APPENDIX
X
159
X-6 Vector maps
X-6.1 pECFP-mito
X-6.2 p_mCherry-C1
APPENDIX
X
160
X-6.3 p_mCherry-Bax
X-6.4 mCherry-Atg5
APPENDIX
X
161
X-6.5 YFP-Bid-CFP
ACKNOWLEDGEMENTS
.
Acknowledgements
I sincerely thank Prof. Dr. Fritz Kreuzaler for serving as my promoter at the RWTH
Aachen, and Dr. habil. Christoph Peterhänsel and Prof. Dr. Margit Frentzen for serving as
members of my thesis committee.
I would like to thank my mentor Dr. Robbie Gottlieb at The Scripps Research Institute
for the opportunity to perform my doctoral studies in her lab. Her guidance and
enthusiasm are reflected throughout this thesis and will continue to inspire me well into
the next stages of my career.
I am grateful to all members of the Gottlieb lab for the nice time spent together; in
particular, Rick Sayen for his technical support, Dr. Asa Gustafsson for the fruitful
collaboration, and Dr. Chengqun Huang for interesting discussions.
Special thanks go to my husband Nathan Brady for the continuous collaboration, his
excitement about our work, and his emotional support.
Much of this work was made possible by the generosity of others: HL-1 cells were kindly
provided by Dr. William Claycomb (LSU Health Sciences Center, Louisiana). I would
like to thank Dr. Richard Youle (National Institutes of Health, Maryland) for pEGFP-
Bax, Dr. Roger Tsien (University of California, San Diego) for pRSET-mCherry, Dr.
Lorie Kirshenbaum for the Bnip3 and Bnip3∆TM constructs, Dr. Atsushi Miyawaki
(Brain Science Institute, RIKEN, Japan) for Venus YFP variant, Dr. David Piston
(Vanderbilt University Medical Center, Tennessee) for Cerulean CFP variant, Dr. Beth
Levine (University of Texas Southwestern, Texas) for flag-Beclin1 and flag-
Beclin1∆Bcl2BD, Dr. Ella Bossy-Wetzel (Burnham Institute, California) for Bcl-xL, Dr.
Harald Stenmark (Norwegian Radium Hospital, Norway) for pEGFP-2xFYVE, Dr.
Tamotsu Yoshimori (National Institute of Genetics, Japan) for GFP-LC3, and Dr. Clark
Distelhorst (Case Western Reserve University, Ohio) for flag-Bcl-2.
Bildungsgang der Verfasserin
1984 – 1988 Gemeinschaftsgundschule Haaren in Aachen
1988 – 1997 Einhard-Gymnasium in Aachen
Abschluß: Allgemeine Hochschulreife
Rheinisch Westfälische Technische Hochschule (RWTH) Aachen, Germany
1997 – 1999 Studium der Anglistik, Biologie und Erziehungswissenschaften
(Lehramt)
1999 – 2003 Studium der Biologie (Diplom)
2002 Forschungspraktikum im Rahmen eines Erasmus-
Austauschprogrammes im Institut für Molekulare Zellphysiologie
der Vrijen Universiteit Amsterdam, Niederlande: “MitoTracker
Green evidences subcellular localization of dihydrolipoamide
dehydrogenase in Paracoccus denitrificans”
2003 Diplomarbeit im Institut für Molekulare Zellphysiologie der Vrijen
Universiteit Amsterdam: “Dynamics of mitochondrial organization
and communication in the adult cardiomyocyte - a study employing
laser scanning confocal microscopy”
Abschluß: Diplom-Biologin, Prädikat: mit Auszeichnung
2003 – 2006 Externe Promotion in der Abteilung für Molekulare &
Experimentelle Medizin des Scripps Research Institutes in La
Jolla, Kalifornien: “The interplay between pro-death and pro-
survival pathways converging at mitochondria in myocardial
ischemia/reperfusion: apoptosis meets autophagy”
Publications
Hamacher-Brady A., Brady N.R., Logue S.E., Sayen M.R., Jinno M., Kirshenbaum
L.A., Gottlieb R.A., and A.B. Gustafsson (2006). “Response to myocardial
ischemia/reperfusion injury involves Bnip3 and autophagy”. Cell Death Differ. 2006 Apr
28
Brady N.R.1, Hamacher-Brady A.
1, and R.A. Gottlieb (2006). “Pro-apoptotic Bcl-2
family members and mitochondrial dysfunction during ischemia/reperfusion injury, a
study employing cardiac HL-1 cells and GFP-biosensors. BBA-Bioenergetics. 2006 May-
Jun;1757(5-6):667-78. (1Authors contributed equally.)
Hamacher-Brady A., Brady N.R., and R.A. Gottlieb. “Enhancing macroautophagy
protects against ischemia/reperfusion injury in cardiac myocytes.” J Biol Chem. 2006
Aug 1
Hamacher-Brady A., Brady N.R., Gottlieb R.A., and AB Gustafsson. Autophagy as a
Protective Response to Bnip3-Mediated Apoptotic Signaling in the Heart. Autophagy.
2006 Oct 25;2(4)
Brady N.R., Hamacher-Brady A., Westerhoff H.V., and R.A. Gottlieb (2006). “A wave
of reactive oxygen species (ROS)-induced ROS release in a sea of excitable
mitochondria.” Antioxid Redox Signal. 2006 Sep-Oct;8(9-10):1651-65. Review.
Hamacher-Brady A., Brady N.R., and R.A. Gottlieb. “The interplay between pro-death
and pro-survival signaling pathways in myocardial ischemia/reperfusion: apoptosis meets
autophagy.” Cardiovasc Drugs Ther. In press. Review.
Huang C., Tsukada Y., Brady N.R., Jinno M., Paromov V., Hamacher-Brady A., and
R.A. Gottlieb. “Reperfusion Injury is Mediated by Reactive Oxygen Species,
Arachidonic Acid Metabolism, and p38 MAPK in a Sulfaphenazole-Sensitive Pathway.”
Submitted.
Brady N.R., Hamacher-Brady A., and R.A. Gottlieb. “Bcl-2 regulation of
sarco/endoplasmic reticulum calcium stores mediates the autophagic response to nutrient
deprivation in the HL-1 cardiac myocyte.” Submitted.
Abstracts
Graduate Research Schools GKB (Berlin) and BCA (Amsterdam) Cell Systems Biology
Meeting, Berlin 2002. Poster: MitoTracker Green evidences subcellular localization of
dihydrolipoamide dehydrogenase in Paracoccus denitrificans.
NOW-CW Study Group on Lipids and Biomembranes, 2003. Poster: MitoTracker Green
evidences subcellular localization of dihydrolipoamide dehydrogenase in Paracoccus
denitrificans.
American Heart Association (AHA), Annual meeting ‘Scientific Sessions 2004’, New
Orleans 2004. Oral presentation: Time-resolved mitochondrial events during simulated
ischemia/reperfusion in adult cardiomyocytes.
International Society of Heart Research (ISHR), Annual meeting, New Orleans 2005.
Poster: Investigating the role of autophagy during simulated ischemia/reperfusion in
cardiac myocytes.
‘Jahrestagung deutscher Nachwuchswissenschaftler’, San Diego 2005. Abstract:
Enhancing macroautophagy protects against ischemia/reperfusion in cardiac myocytes.
American Heart Association (AHA), Annual meeting ‘Scientific Sessions 2005’, Dallas
2005. Poster (1): Mitochondrial autophagy (mitophagy) functions as a survival response
during ischemia/reperfusion injury in cardiac myocytes. Poster (2): Bnip3 Triggers
Mitochondrial Fragmentation and Autophagy in Ischemia/ Reperfusion.